Detailed information



This page of PtRNAdb provides more detailed information about individual tRNA present in the database. Further, by clicking on the isoacceptor or isodecoder name, user can view the consensus based study results of all the tRNAs from the respective plant and isoacceptor/isodecoder.


PtRNAdb ID86072_PtRNAdb
Plant SourceTrifolium pratense     |     Phanerogamae -->Dicot
Genome levelNuclear
tRNA IDchr-7.trna107
tRNA locuschr-7 : 14366360 - 14366287 (-)
IsoacceptorAsn

[NOTE: User can view the results of the consensus based study of all the tRNAs of Asn isoacceptor in Trifolium_pratense plant by clicking on the isoacceptor]

IsodecoderGTT

[NOTE: User can view the results of the consensus based study of all the tRNAs of GTT isodecoder in Trifolium_pratense plant by clicking on the isodecoder]

tRNA Sequence
GCTGGAATAGCTCAGTTGGTTAGAGCGTGTGGCTGTTAACCACAAGGTCGGAGGTTCAACCCCTCCTTCTAGCG
tRNA secondary structure
>>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
Upstream sequence (upto 100nt)
TGTCTGTACTTTGTAGGGTTATTTTGACATAGAAATGTTGGTGAGAGGGTGCGTGTATGATAGAATAATAAAAATGTAATTATTGTTTTCCAAATCAAAA
Downstream sequence (upto 100nt)
TTTTAATTTTTTTTTCTCTCATTTTTTTTGTGGTTTGTATCTTTCATTAATGGTAGAGAACATAAGTATGCTCATAGAGCAAATATTATAAATTCTGAGT
Mature tRNA
GCUGGAAUAGCUCAGUUGGUUAGAGCGUGUGGCUGUUAACCACAAGGUCGGAGGUUCAACCCCUCCUUCUAGCG
HMM Score57.10
Secondary structure Score25.20