Detailed information



This page of PtRNAdb provides more detailed information about individual tRNA present in the database. Further, by clicking on the isoacceptor or isodecoder name, user can view the consensus based study results of all the tRNAs from the respective plant and isoacceptor/isodecoder.


PtRNAdb ID82542_PtRNAdb
Plant SourceSolanum lycopersicum     |     Phanerogamae -->Dicot
Genome levelNuclear
tRNA IDchr-5.trna3
tRNA locuschr-5 : 4091586 - 4091659 (+)
IsoacceptorIle

[NOTE: User can view the results of the consensus based study of all the tRNAs of Ile isoacceptor in Solanum_lycopersicum plant by clicking on the isoacceptor]

IsodecoderAAT

[NOTE: User can view the results of the consensus based study of all the tRNAs of AAT isodecoder in Solanum_lycopersicum plant by clicking on the isodecoder]

tRNA Sequence
A-Box B-Box
GGCCTATTAGCTCAGTTGGTTAGAGCGTCGTGCTAATAACGCGAAGGTCGCAGGTTCGAGACCTGCATGGGCCA
tRNA secondary structure
>>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
Upstream sequence (upto 100nt)
ACCCTTCATTTACTCTCTTTGTCCAAATAATATTCTAAACAAAGCATAGTAAACAACGAAATAAATATCTTAATGATAAAATGGACATTTGTACCCACTT
Downstream sequence (upto 100nt)
TAACATTTTTTAAGATTTATTAAAAATATTTCACATAGATTGAGATATATATTTAACAAACCATTTTGGATCGACCTCTCGTGTTATGAGTACCGTCTTT
Mature tRNA
GGCCUAUUAGCUCAGUUGGUUAGAGCGUCGUGCUAAUAACGCGAAGGUCGCAGGUUCGAGACCUGCAUGGGCCA
HMM Score58.30
Secondary structure Score23.50