Detailed information



This page of PtRNAdb provides more detailed information about individual tRNA present in the database. Further, by clicking on the isoacceptor or isodecoder name, user can view the consensus based study results of all the tRNAs from the respective plant and isoacceptor/isodecoder.


PtRNAdb ID75786_PtRNAdb
Plant SourceRaphanus sativus     |     Phanerogamae -->Dicot
Genome levelNuclear
tRNA IDchr-LG1.trna12
tRNA locuschr-LG1 : 5984630 - 5984714 (+)
IsoacceptorMet

[NOTE: User can view the results of the consensus based study of all the tRNAs of Met isoacceptor in Raphanus_sativus plant by clicking on the isoacceptor]

IsodecoderCAT

[NOTE: User can view the results of the consensus based study of all the tRNAs of CAT isodecoder in Raphanus_sativus plant by clicking on the isodecoder]

tRNA Sequence
A-Box B-Box
GGGGTGGTGGCGCAGTTGGCTAGCGCGTAGGTCTCATAGCTACTGAGTGATCCTGAGGTCGAGAGTTCGAGCCTCTCTCACCCCA
tRNA secondary structure
>>>>>>>..>>>>.........<<<<.>>>>....................<<<<.....>>>>>.......<<<<<<<<<<<<.
Upstream sequence (upto 100nt)
GTTTCAGCTGGCGGTAACTCTTTAGAATATTCATGCGAGGCTAAAGATGTTGTACAAAACTTGCAAGACATCAAGATGAAACAATCATTTAATAACAAAT
Downstream sequence (upto 100nt)
TAATTTTTTTTTGTCTTTTCTTTCTAGGAATCGAATCTTGCTAACGAGTAGTGTTTCGCTGGTCCATTCCTCCTCTCGACAAGCAACCGCAGTCATACAT
Mature tRNA
GGGGUGGUGGCGCAGUUGGCUAGCGCGUAGGUCUCAUAAUCCUGAGGUCGAGAGUUCGAGCCUCUCUCACCCCA
Intron Sequence
GCTACTGAGTG
Intron Position39-49
Infernal Score64.2
HMM Score40.80
Secondary structure Score23.40