Detailed information



This page of PtRNAdb provides more detailed information about individual tRNA present in the database. Further, by clicking on the isoacceptor or isodecoder name, user can view the consensus based study results of all the tRNAs from the respective plant and isoacceptor/isodecoder.


PtRNAdb ID75280_PtRNAdb
Plant SourceQuercus lobata     |     Phanerogamae -->Dicot
Genome levelNuclear
tRNA IDchr-1.trna67
tRNA locuschr-1 : 15333232 - 15333144 (-)
IsoacceptorTyr

[NOTE: User can view the results of the consensus based study of all the tRNAs of Tyr isoacceptor in Quercus_lobata plant by clicking on the isoacceptor]

IsodecoderGTA

[NOTE: User can view the results of the consensus based study of all the tRNAs of GTA isodecoder in Quercus_lobata plant by clicking on the isodecoder]

tRNA Sequence
A-Box B-Box
CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGTTGGCAATAACAGCTGATCCTTAGGTCACTGGTTCGAATCCGGTAGGTCGGA
tRNA secondary structure
>>>>>>>..>>>>........<<<<.>>>>>.......................<<<<<.....>>>>>.......<<<<<<<<<<<<.
Upstream sequence (upto 100nt)
CATACTGTTTGGCGCTTGGAAGTTGGAAGAAATTAGAAAATTAAGAAATCGTTGAATAAATTAGCTATATATATTATTTTATTTATAGCAATTATCAAAT
Downstream sequence (upto 100nt)
CAATTTTTTTCCTTTTTCTTTTTTCCCCCACTTTCATTATTCACTCAGAGCCATTGGTGTTTCGTGCAAATATCATCTTTAGCCCTGATTGTTAAATCTT
Mature tRNA
CCGACCUUAGCUCAGUUGGUAGAGCGGAGGACUGUAGAUCCUUAGGUCACUGGUUCGAAUCCGGUAGGUCGGA
Intron Sequence
TTGGCAATAACAGCTG
Intron Position38-53
Infernal Score72.1
HMM Score38.80
Secondary structure Score33.30