Detailed information



This page of PtRNAdb provides more detailed information about individual tRNA present in the database. Further, by clicking on the isoacceptor or isodecoder name, user can view the consensus based study results of all the tRNAs from the respective plant and isoacceptor/isodecoder.


PtRNAdb ID70334_PtRNAdb
Plant SourcePapaver somniferum     |     Phanerogamae -->Dicot
Genome levelNuclear
tRNA IDchr-2.trna47
tRNA locuschr-2 : 60459779 - 60459867 (+)
IsoacceptorMet

[NOTE: User can view the results of the consensus based study of all the tRNAs of Met isoacceptor in Papaver_somniferum plant by clicking on the isoacceptor]

IsodecoderCAT

[NOTE: User can view the results of the consensus based study of all the tRNAs of CAT isodecoder in Papaver_somniferum plant by clicking on the isodecoder]

tRNA Sequence
A-Box B-Box
GGGGCGGTGGCGCAGTTGGCTAGCGCGTAGGTCTCATAGCTATTTATTGAGTGATCCTGAGGTCGAGAGTTCGAGCCTCTCTCGCCCCA
tRNA secondary structure
>>>>>>>..>>>>.........<<<<.>>>>........................<<<<.....>>>>>.......<<<<<<<<<<<<.
Upstream sequence (upto 100nt)
GAATTTTGGGTGTAGGGCACCTTAGTCAAAATTGTTAACTGATGATGTCCTTCTCATAGGTAAATGGTTCTTAATTTAGAATTATCGGAATTTCACAACT
Downstream sequence (upto 100nt)
ACTCTTTTTTTTTTTTGCTCGAATTCTTTTCCAGTCACTACATTTGACAAGTATTGTACTGCATCGAAAAGGCATGGACCGGAGGGCACACAAAAGAACC
Mature tRNA
GGGGCGGUGGCGCAGUUGGCUAGCGCGUAGGUCUCAUAAUCCUGAGGUCGAGAGUUCGAGCCUCUCUCGCCCCA
Intron Sequence
GCTATTTATTGAGTG
Intron Position39-53
Infernal Score64.4
HMM Score41.10
Secondary structure Score23.30