Detailed information



This page of PtRNAdb provides more detailed information about individual tRNA present in the database. Further, by clicking on the isoacceptor or isodecoder name, user can view the consensus based study results of all the tRNAs from the respective plant and isoacceptor/isodecoder.


PtRNAdb ID67590_PtRNAdb
Plant SourcePanicum hallii     |     Phanerogamae -->Monocot
Genome levelNuclear
tRNA IDchr-1.trna40
tRNA locuschr-1 : 54543027 - 54543098 (+)
IsoacceptorTrp

[NOTE: User can view the results of the consensus based study of all the tRNAs of Trp isoacceptor in Panicum_hallii plant by clicking on the isoacceptor]

IsodecoderCCA

[NOTE: User can view the results of the consensus based study of all the tRNAs of CCA isodecoder in Panicum_hallii plant by clicking on the isodecoder]

tRNA Sequence
GGATCCGTGGCGCAATGGTAGCGCGTCTGACTCCAGATCAGAAGGTTGCGTGTTCGATTCACGTCGGGTTCA
tRNA secondary structure
>>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
Upstream sequence (upto 100nt)
ACGAGCAAAAGCATTCGTTGAACTAGAGCCCAGCAATGCAGAAATTTTGTGGCTGGATCAGTACACTATTTATTATTGCGTTATGAGTATCGGCCACCAA
Downstream sequence (upto 100nt)
AACCCCCGGTCCAAGCGGATCTTCTTTTATTTTTGCCTAATGCTCCTGTGTAATTCGTCCAATCCCCGCCGTCCATCTACCACTAAGCATCCGCAGCCGC
Mature tRNA
GGAUCCGUGGCGCAAUGGUAGCGCGUCUGACUCCAGAUCAGAAGGUUGCGUGUUCGAUUCACGUCGGGUUCA
HMM Score51.20
Secondary structure Score24.60