Detailed information



This page of PtRNAdb provides more detailed information about individual tRNA present in the database. Further, by clicking on the isoacceptor or isodecoder name, user can view the consensus based study results of all the tRNAs from the respective plant and isoacceptor/isodecoder.


PtRNAdb ID66261_PtRNAdb
Plant SourceOryza meridionalis     |     Phanerogamae -->Monocot
Genome levelNuclear
tRNA IDchr-2.trna50
tRNA locuschr-2 : 10447342 - 10447271 (-)
IsoacceptorGln

[NOTE: User can view the results of the consensus based study of all the tRNAs of Gln isoacceptor in Oryza_meridionalis plant by clicking on the isoacceptor]

IsodecoderTTG

[NOTE: User can view the results of the consensus based study of all the tRNAs of TTG isodecoder in Oryza_meridionalis plant by clicking on the isodecoder]

tRNA Sequence
A-Box B-Box
GGTTCCATAGTGTAGTGGTTAGCACTCCAGACTTTGAATCTGGCAACCTGGGTTCGAATCCCGGTGGGACCT
tRNA secondary structure
>>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
Upstream sequence (upto 100nt)
AAAAAGGAAAAGATAAAAAAGGACGTAGACAAATTTCCTGCCTTTTGCTTTTTTGTGGAATGACAGAAATGTCATCAGCAAGGGACCAAATACAACATCT
Downstream sequence (upto 100nt)
CTTTTTTGGTATTGCCATAGTCCTCAAATGGGATCTATATAGCCAATTGCTTGCAGGGCGAATACATGATTCATGATTTGTTATACATATAATAGTTTTG
Mature tRNA
GGUUCCAUAGUGUAGUGGUUAGCACUCCAGACUUUGAAUCUGGCAACCUGGGUUCGAAUCCCGGUGGGACCU
HMM Score52.30
Secondary structure Score20.30