Detailed information



This page of PtRNAdb provides more detailed information about individual tRNA present in the database. Further, by clicking on the isoacceptor or isodecoder name, user can view the consensus based study results of all the tRNAs from the respective plant and isoacceptor/isodecoder.


PtRNAdb ID65583_PtRNAdb
Plant SourceOryza longistaminata     |     Phanerogamae -->Monocot
Genome levelNuclear
tRNA IDchr-12.trna23
tRNA locuschr-12 : 18566646 - 18566719 (+)
IsoacceptorThr

[NOTE: User can view the results of the consensus based study of all the tRNAs of Thr isoacceptor in Oryza_longistaminata plant by clicking on the isoacceptor]

IsodecoderAGT

[NOTE: User can view the results of the consensus based study of all the tRNAs of AGT isodecoder in Oryza_longistaminata plant by clicking on the isodecoder]

tRNA Sequence
A-Box B-Box
GCTTTCGTAGCTCAGTTGGTTAGAGCACCCGTTTAGTAAGCGGGAGGTCTTGAGTTCGACTCTCAACGAAAGCA
tRNA secondary structure
>>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
Upstream sequence (upto 100nt)
GTACTCTTTTTCACTCCCACACATACACTTATGCTATTGGTTGATGCTTACCATGATGATGCATCGGTGAGATAAGATTTCCAACAAATTTCACTAAGCT
Downstream sequence (upto 100nt)
TTTTTATTACTTTTTTTCATTTTTACTTTTTTTGTATTCTTTTGTTTTTCTTGTAATCAGCTGGTTGCCACATCTTCTTCCTTTGAGCTCAACTGATTGA
Mature tRNA
GCUUUCGUAGCUCAGUUGGUUAGAGCACCCGUUUAGUAAGCGGGAGGUCUUGAGUUCGACUCUCAACGAAAGCA
HMM Score46.80
Secondary structure Score28.20