This page of PtRNAdb provides more detailed information about individual tRNA present in the database. Further, by clicking on the isoacceptor or isodecoder name, user can view the consensus based study results of all the tRNAs from the respective plant and isoacceptor/isodecoder.
| PtRNAdb ID | 6521_PtRNAdb |
|---|---|
| Plant Source | Arachis hypogaea | Phanerogamae -->Dicot |
| Genome level | Nuclear |
| tRNA ID | chr-A01.trna24 |
| tRNA locus | chr-A01 : 42021342 - 42021428 (+) |
| Isoacceptor | Ser [NOTE: User can view the results of the consensus based study of all the tRNAs of Ser isoacceptor in Arachis_hypogaea plant by clicking on the isoacceptor] |
| Isodecoder | GCT [NOTE: User can view the results of the consensus based study of all the tRNAs of GCT isodecoder in Arachis_hypogaea plant by clicking on the isodecoder] |
| tRNA Sequence A-Box B-Box | GGAGAGATGGCTGAGTGGACTAAAGCACCGGATTGCTAATCCGTTGTACGAATTTTTGTACCGAGGGTTCGAATCCATCTCTTTCCG |
| tRNA secondary structure | >>>>>>>..>>>...........<<<..>>>>.......<<<<..>>>>>>....<<<<<<.>>.>>.......<<.<<<<<<<<<. |
| Upstream sequence (upto 100nt) | AAAGCATTCAATCCGTGAGCCCAGAGTATTCGTGGTATAAGCTAGAACCAATTGGTAGCATTCTTGAGATCCGAACAATATATATAGATATCGCAATTGG |
| Downstream sequence (upto 100nt) | TTTCCACCTGTGAGTTAGTATTTTTTTCTTTTGAATTTTCATCAAACCAAGCCTCAGCAATTTCGGAATCTCCCTATCGAATGGCCTGTTCTCCGCGGCC |
| Mature tRNA | GGAGAGAUGGCUGAGUGGACUAAAGCACCGGAUUGCUAAUCCGUUGUACGAAUUUUUGUACCGAGGGUUCGAAUCCAUCUCUUUCCG |
| HMM Score | 37.00 |
| Secondary structure Score | 7.80 |
© Developed by Dr. Shailesh Laboratory | National Institute of Plant Genome Research (NIPGR), New Delhi, India | DBT