Detailed information



This page of PtRNAdb provides more detailed information about individual tRNA present in the database. Further, by clicking on the isoacceptor or isodecoder name, user can view the consensus based study results of all the tRNAs from the respective plant and isoacceptor/isodecoder.


PtRNAdb ID64321_PtRNAdb
Plant SourceOryza barthii     |     Phanerogamae -->Monocot
Genome levelNuclear
tRNA IDchr-3.trna6
tRNA locuschr-3 : 4345156 - 4345240 (+)
IsoacceptorTyr

[NOTE: User can view the results of the consensus based study of all the tRNAs of Tyr isoacceptor in Oryza_barthii plant by clicking on the isoacceptor]

IsodecoderGTA

[NOTE: User can view the results of the consensus based study of all the tRNAs of GTA isodecoder in Oryza_barthii plant by clicking on the isodecoder]

tRNA Sequence
A-Box B-Box
CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGTTGTTGCAGGTAATCCTTAGGTCGCTGGTTCGAATCCGGCAGGTCGGA
tRNA secondary structure
>>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
Upstream sequence (upto 100nt)
AAACCATTTTACTTTCGCATGTGTCGTATTTACAATATAAATTTAACAGCAAACTGTAGAGAACGAATCAATAATATATCGATAGACAAATCAACGCAAA
Downstream sequence (upto 100nt)
TTTTTTCTTTTTATAGCTTATTTTTTCTTTTTATAGCTTCTCAATGAAGTTAAACACCTCAAACCATTTCGTGATGTTAGATTGTGATCTAATGATATGT
Mature tRNA
CCGACCUUAGCUCAGUUGGUAGAGCGGAGGACUGUAGAUCCUUAGGUCGCUGGUUCGAAUCCGGCAGGUCGGA
Intron Sequence
TTGTTGCAGGTA
Intron Position38-49
Infernal Score74.5
HMM Score43.00
Secondary structure Score31.50