Detailed information



This page of PtRNAdb provides more detailed information about individual tRNA present in the database. Further, by clicking on the isoacceptor or isodecoder name, user can view the consensus based study results of all the tRNAs from the respective plant and isoacceptor/isodecoder.


PtRNAdb ID60429_PtRNAdb
Plant SourceMusa acuminata     |     Phanerogamae -->Monocot
Genome levelNuclear
tRNA IDchr-11.trna37
tRNA locuschr-11 : 16438388 - 16438461 (+)
IsoacceptorArg

[NOTE: User can view the results of the consensus based study of all the tRNAs of Arg isoacceptor in Musa_acuminata plant by clicking on the isoacceptor]

IsodecoderTCG

[NOTE: User can view the results of the consensus based study of all the tRNAs of TCG isodecoder in Musa_acuminata plant by clicking on the isodecoder]

tRNA Sequence
A-Box B-Box
GACCGCATAGCGCAGTGGATTAGCGCGTCTGACTTCGGATCAGAAGGTCGTGGGTTCGACTCCCACTGTGGTCG
tRNA secondary structure
>>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
Upstream sequence (upto 100nt)
AACGAGAACGAGAACGAGAGAAGATGGAAATTGATCCCGTGGAAGAACAGAAATTATTACAGCTGTTATATATCTTGAAATTGAAACGTAAGCAATGAGT
Downstream sequence (upto 100nt)
TTTTCATTTTTGTTTTTCTTATGTCCTTTAAAAAATAGAGATATAGAAAATCTTAAAAAAATGTTTTTTTGTCTTTTCAGTGTCCTTAAAAAAAATAGAA
Mature tRNA
GACCGCAUAGCGCAGUGGAUUAGCGCGUCUGACUUCGGAUCAGAAGGUCGUGGGUUCGACUCCCACUGUGGUCG
HMM Score60.40
Secondary structure Score21.50