Detailed information



This page of PtRNAdb provides more detailed information about individual tRNA present in the database. Further, by clicking on the isoacceptor or isodecoder name, user can view the consensus based study results of all the tRNAs from the respective plant and isoacceptor/isodecoder.


PtRNAdb ID50120_PtRNAdb
Plant SourceIpomoea trifida     |     Phanerogamae -->Dicot
Genome levelNuclear
tRNA IDchr-06.trna32
tRNA locuschr-06 : 17778217 - 17778287 (+)
IsoacceptorGly

[NOTE: User can view the results of the consensus based study of all the tRNAs of Gly isoacceptor in Ipomoea_trifida plant by clicking on the isoacceptor]

IsodecoderCCC

[NOTE: User can view the results of the consensus based study of all the tRNAs of CCC isodecoder in Ipomoea_trifida plant by clicking on the isodecoder]

tRNA Sequence
A-Box B-Box
GCGCATCTGGTGTAGTGGTATCATAGTACCCTCCCACGGTACTGACCAGGGTTCGATTCCCTGGATGCGCA
tRNA secondary structure
>>>>>>>..>>>.........<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
Upstream sequence (upto 100nt)
AATCATTGTTCTGAATAGAAAATATATATAGAGTAAATACTTTAAGGTTCTATAATATTATGTGTTTAATTTGAGCTAAAACACAGTACCTACCAGAGAA
Downstream sequence (upto 100nt)
GTTATTCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCATTTTTACCCAGGGGGTCATGTTCTTTGCGGATTGCGGAAGACTCAAATTGTACTTCAAATC
Mature tRNA
GCGCAUCUGGUGUAGUGGUAUCAUAGUACCCUCCCACGGUACUGACCAGGGUUCGAUUCCCUGGAUGCGCA
HMM Score28.10
Secondary structure Score37.30