Detailed information



This page of PtRNAdb provides more detailed information about individual tRNA present in the database. Further, by clicking on the isoacceptor or isodecoder name, user can view the consensus based study results of all the tRNAs from the respective plant and isoacceptor/isodecoder.


PtRNAdb ID4581_PtRNAdb
Plant SourceArabidopsis thaliana     |     Phanerogamae -->Dicot
Genome levelNuclear
tRNA IDchr-1.trna110
tRNA locuschr-1 : 20948323 - 20948407 (+)
IsoacceptorTyr

[NOTE: User can view the results of the consensus based study of all the tRNAs of Tyr isoacceptor in Arabidopsis_thaliana plant by clicking on the isoacceptor]

IsodecoderGTA

[NOTE: User can view the results of the consensus based study of all the tRNAs of GTA isodecoder in Arabidopsis_thaliana plant by clicking on the isodecoder]

tRNA Sequence
A-Box B-Box
CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGTAGACGCAGATTATCCTTAGGTCACTGGTTCGAATCCGGTAGGTCGGA
tRNA secondary structure
>>>>>>>..>>>>........<<<<.>>>>>...................<<<<<.....>>>>>.......<<<<<<<<<<<<.
Upstream sequence (upto 100nt)
AATTTGTAATAGAGACTCACTATGAGTATGCTAACTTAATACAAATCATTGTGTTCATAGAATATTTAGATCAGTACACATGCATGAAATAGATTACAAT
Downstream sequence (upto 100nt)
ATTTGCTCCCACATGAGAGCTTTTTATTTTCTTTTGTTGTGACATTAAGGTTTTTGAATTTTATAATAAACGGTTATATGGTGGTCGATAATTAAACATA
Mature tRNA
CCGACCUUAGCUCAGUUGGUAGAGCGGAGGACUGUAGAUCCUUAGGUCACUGGUUCGAAUCCGGUAGGUCGGA
Intron Sequence
TAGACGCAGATT
Intron Position38-49
Infernal Score72.2
HMM Score38.90
Secondary structure Score33.30