Detailed information



This page of PtRNAdb provides more detailed information about individual tRNA present in the database. Further, by clicking on the isoacceptor or isodecoder name, user can view the consensus based study results of all the tRNAs from the respective plant and isoacceptor/isodecoder.


PtRNAdb ID43126_PtRNAdb
Plant SourceGossypium arboreum     |     Phanerogamae -->Dicot
Genome levelNuclear
tRNA IDchr-13.trna104
tRNA locuschr-13 : 63324148 - 63324054 (-)
IsoacceptorTyr

[NOTE: User can view the results of the consensus based study of all the tRNAs of Tyr isoacceptor in Gossypium_arboreum plant by clicking on the isoacceptor]

IsodecoderGTA

[NOTE: User can view the results of the consensus based study of all the tRNAs of GTA isodecoder in Gossypium_arboreum plant by clicking on the isodecoder]

tRNA Sequence
A-Box B-Box
CCGACCTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGTGGGCATGGCCTTGCTGTAAAAATCCTTAGGTCGCTGGTTCGAATCCGGCAGGTCGGA
tRNA secondary structure
>>>>>>>..>>>>........<<<<.>>>>>.............................<<<<<.....>>>>>.......<<<<<<<<<<<<.
Upstream sequence (upto 100nt)
TGTTATGTATATAAATAAAAATCTGTTATCACTAATAATATAAAGTCAAGAAAACAAAAACTTAATATTTTTAAAATGTTTTCTAGCAGCTGACTCAAGT
Downstream sequence (upto 100nt)
TATTTTCTAAACTTTTGCCTTTTCGGTTAAATTTGTTCTAAGTCCCTGTAATCATTGTAAATTTCGAATTTAGTCTTTCTAAATTTATTTCAGTAAATTT
Mature tRNA
CCGACCUUAGCUCAGUUGGUAGAGCGGAGGACUGUAGAUCCUUAGGUCGCUGGUUCGAAUCCGGCAGGUCGGA
Intron Sequence
TGGGCATGGCCTTGCTGTAAAA
Intron Position38-59
Infernal Score74.1
HMM Score42.60
Secondary structure Score31.50