Detailed information



This page of PtRNAdb provides more detailed information about individual tRNA present in the database. Further, by clicking on the isoacceptor or isodecoder name, user can view the consensus based study results of all the tRNAs from the respective plant and isoacceptor/isodecoder.


PtRNAdb ID42374_PtRNAdb
Plant SourceGossypioides kirkii     |     Phanerogamae -->Dicot
Genome levelNuclear
tRNA IDchr-KI_10.trna34
tRNA locuschr-KI_10 : 29985761 - 29985852 (+)
IsoacceptorLeu

[NOTE: User can view the results of the consensus based study of all the tRNAs of Leu isoacceptor in Gossypioides_kirkii plant by clicking on the isoacceptor]

IsodecoderTAA

[NOTE: User can view the results of the consensus based study of all the tRNAs of TAA isodecoder in Gossypioides_kirkii plant by clicking on the isodecoder]

tRNA Sequence
A-Box B-Box
GGAGAGATGGCTGAGTGGTTGATAGCTTCGGTCTTAAAAAACCGGTATAGTTTGAAACAAAGAACTATCGAGGGTTCGAATCGCTCTCTCCT
tRNA secondary structure
>>>>>>>..>>>>.........<<<<.>>>>>..................................<<<<<..>.......<..<<<<<<<.
Upstream sequence (upto 100nt)
ATAGGTTCACACACGATATCTTTCTATACATAGTAATGGTATCAACTCATATGGCCATGTTCGATTCAGTGGAATAAAAATAAAATAGAAATTATCTTTC
Downstream sequence (upto 100nt)
TTTGCTCGATGAATTGATTTCTTTCTTTATTAAATTTTCCTGTCTTCTTAATTAAGAATCTTAATATTAATAAAAGGTAATGGCTCGGTTGGGTGGAATA
Mature tRNA
GGAGAGAUGGCUGAGUGGUUGAUAGCUUCGGUCUUAAAUAUCGAGGGUUCGAAUCGCUCUCUCCU
Intron Sequence
AAACCGGTATAGTTTGAAACAAAGAAC
Intron Position39-65
Infernal Score24.9
HMM Score17.80
Secondary structure Score7.10