Detailed information



This page of PtRNAdb provides more detailed information about individual tRNA present in the database. Further, by clicking on the isoacceptor or isodecoder name, user can view the consensus based study results of all the tRNAs from the respective plant and isoacceptor/isodecoder.


PtRNAdb ID25637_PtRNAdb
Plant SourceCapsicum annuum     |     Phanerogamae -->Dicot
Genome levelNuclear
tRNA IDchr-7.trna54
tRNA locuschr-7 : 224167154 - 224167082 (-)
IsoacceptorPhe

[NOTE: User can view the results of the consensus based study of all the tRNAs of Phe isoacceptor in Capsicum_annuum plant by clicking on the isoacceptor]

IsodecoderGAA

[NOTE: User can view the results of the consensus based study of all the tRNAs of GAA isodecoder in Capsicum_annuum plant by clicking on the isodecoder]

tRNA Sequence
GCGGGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGTCACGTGTTCGATCCATGTTCACCGCA
tRNA secondary structure
>>>>.>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<.<<<<.
Upstream sequence (upto 100nt)
AGTATTTCGACCTTAAATATTTTGAATTGCTCTTCAAAAAAATTTGGGAAAATAATATTTCATAATAGTAAATACAAAATAAAGAACAACTAAACAACAA
Downstream sequence (upto 100nt)
TTCTATTTTTGTAATATTTTTCGTTCCTTTTTTGTTGGATATAATGGGCTAATATGCCAATGAGGCCCATGCAACTTTTCGTTTTCATTTTTTCTTATTA
Mature tRNA
GCGGGGAUAGCUCAGUUGGGAGAGCGUCAGACUGAAGAUCUGAAGGUCACGUGUUCGAUCCAUGUUCACCGCA
HMM Score52.50
Secondary structure Score17.40