Detailed information



This page of PtRNAdb provides more detailed information about individual tRNA present in the database. Further, by clicking on the isoacceptor or isodecoder name, user can view the consensus based study results of all the tRNAs from the respective plant and isoacceptor/isodecoder.


PtRNAdb ID13111_PtRNAdb
Plant SourceBeta vulgaris     |     Phanerogamae -->Dicot
Genome levelNuclear
tRNA IDchr-5.trna101
tRNA locuschr-5 : 29384372 - 29384301 (-)
IsoacceptorArg

[NOTE: User can view the results of the consensus based study of all the tRNAs of Arg isoacceptor in Beta_vulgaris plant by clicking on the isoacceptor]

IsodecoderTCT

[NOTE: User can view the results of the consensus based study of all the tRNAs of TCT isodecoder in Beta_vulgaris plant by clicking on the isodecoder]

tRNA Sequence
GCGTCCATAGTCTAATGGATAGGACATAGGTCTTCTAAACCTTTGGTATAGGTTCAAATCCTATTGGACGCA
tRNA secondary structure
>>>>>>>..>>>>........<<<<..>>>>.......<<<<.....>>>>>.......<<<<<<<<<<<<.
Upstream sequence (upto 100nt)
ACGCAATTCAAAAAAATTCTCTCATCTCACATTCCATACAATCGGATTCTTTTTTCGAAACAAAAAAGAAGTACAAAATGCTAAAAAATCGGAATGAAAA
Downstream sequence (upto 100nt)
AATTATTTCCATATATTTCTTTAAGATATCAATGTGAAAAAATGGTAATTTTTTTTTTAATATTAAAAAAAAATTAAGAAGGATCCATTTCTTTGTACAA
Mature tRNA
GCGUCCAUAGUCUAAUGGAUAGGACAUAGGUCUUCUAAACCUUUGGUAUAGGUUCAAAUCCUAUUGGACGCA
HMM Score35.00
Secondary structure Score24.80