Detailed information



This page of PtRNAdb provides more detailed information about individual tRNA present in the database. Further, by clicking on the isoacceptor or isodecoder name, user can view the consensus based study results of all the tRNAs from the respective plant and isoacceptor/isodecoder.


PtRNAdb ID113115_PtRNAdb
Plant SourceCitrus sinensis     |     Phanerogamae -->Dicot
Genome levelMitochondrial
tRNA IDMt.trna15
tRNA locusMt : 301790 - 301866 (+)
IsoacceptorPro

[NOTE: User can view the results of the consensus based study of all the tRNAs of Pro isoacceptor in Citrus_sinensis plant by clicking on the isoacceptor]

IsodecoderTGG

[NOTE: User can view the results of the consensus based study of all the tRNAs of TGG isodecoder in Citrus_sinensis plant by clicking on the isodecoder]

tRNA Sequence
AGGGATGTAGCGCAGCTTGGTAGCGCGTTTGTTTTGGGTACAAAATGTCACGGGTTCAAATCCTGTCATCCCTACCA
tRNA secondary structure
>>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
Upstream sequence (upto 100nt)
AAAGGCAAGATCCATTTTGCATATCACTAGAGGGAATAAAAAATAAGGATGTGGAAAACAAGACAGGGATTCTTTACAATGATATTGTAGGCCAATTGAA
Downstream sequence (upto 100nt)
ATTACCGCTCAGAGCAGCAGTAACGCGAGATTCTTTTTTTTTTTTTTTCGTATCGATTTCATTTTGACATACATAAATTTCTATTTTATGATATATGATA
Mature tRNA
AGGGAUGUAGCGCAGCUUGGUAGCGCGUUUGUUUUGGGUACAAAAUGUCACGGGUUCAAAUCCUGUCAUCCCUACCA
HMM Score40.90
Secondary structure Score24.70
[:(]