Detailed information



This page of PtRNAdb provides more detailed information about individual tRNA present in the database. Further, by clicking on the isoacceptor or isodecoder name, user can view the consensus based study results of all the tRNAs from the respective plant and isoacceptor/isodecoder.


PtRNAdb ID113024_PtRNAdb
Plant SourceBrassica rapa     |     Phanerogamae -->Dicot
Genome levelMitochondrial
tRNA IDMt.trna2
tRNA locusMt : 31664 - 31748 (+)
IsoacceptorLeu

[NOTE: User can view the results of the consensus based study of all the tRNAs of Leu isoacceptor in Brassica_rapa plant by clicking on the isoacceptor]

IsodecoderCAA

[NOTE: User can view the results of the consensus based study of all the tRNAs of CAA isodecoder in Brassica_rapa plant by clicking on the isodecoder]

tRNA Sequence
GCCTTGGTGGTGAAATGGTAGACACGCGAGACTCAAAATCTCGTGCTAAAGAGCGTGGAGGTTCGAGGAACGCCTCTTCAAGGCA
tRNA secondary structure
>>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>....<<<..>>>>>...........<<<<<<<<<<<<.
Upstream sequence (upto 100nt)
ATTAATGTGCCCCTTTGCTACTGCTGCCATACCACATTCAGTCCAATTGGCCATACTAGATAGATATCATATTTATGGAATACGATTCACTCCGATGAAC
Downstream sequence (upto 100nt)
TAATATTGAAATGGAATAAGTTCGGCAGCGGATCGCGAAATCTTGGCGATCTTCTCTATCTAATGAATGGGGAGGGGGAGTCCGCTTTGAAATCGTCCGC
Mature tRNA
GCCUUGGUGGUGAAAUGGUAGACACGCGAGACUCAAAAUCUCGUGCUAAAGAGCGUGGAGGUUCGAGGAACGCCUCUUCAAGGCA
HMM Score19.40
Secondary structure Score22.00