Detailed information



This page of PtRNAdb provides more detailed information about individual tRNA present in the database. Further, by clicking on the isoacceptor or isodecoder name, user can view the consensus based study results of all the tRNAs from the respective plant and isoacceptor/isodecoder.


PtRNAdb ID112784_PtRNAdb
Plant SourceZea mays     |     Phanerogamae -->Monocot
Genome levelPlastid
tRNA IDchl.trna26
tRNA locuschl : 65918 - 65845 (-)
IsoacceptorTrp

[NOTE: User can view the results of the consensus based study of all the tRNAs of Trp isoacceptor in Zea_mays plant by clicking on the isoacceptor]

IsodecoderCCA

[NOTE: User can view the results of the consensus based study of all the tRNAs of CCA isodecoder in Zea_mays plant by clicking on the isodecoder]

tRNA Sequence
GCGCTCTTAGTTCAGTTTGGTAGAACGCGGGTCTCCAAAACCCGATGTCGTAGGTTCAAATCCTACAGAGCGTG
tRNA secondary structure
>>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
Upstream sequence (upto 100nt)
AGATCGATTAAAGTGGGTATAACTTGAATTTGTGGATACTATACGGACGTGAGACACGTTAGGAATAGAAAAGGATTTTCTTTTTTTTTTTGTTTTGAAA
Downstream sequence (upto 100nt)
ATTCCATATATCTTATGTCGAAACTAAAATAACTTAAAAAAAAACAAAGTAGAATTGCAACTCCAATTTGACCTCCTCCAGACCAGAGAGGAGGTCAATC
Mature tRNA
GCGCUCUUAGUUCAGUUUGGUAGAACGCGGGUCUCCAAAACCCGAUGUCGUAGGUUCAAAUCCUACAGAGCGUG
HMM Score42.90
Secondary structure Score29.00
[:(]