Detailed information



This page of PtRNAdb provides more detailed information about individual tRNA present in the database. Further, by clicking on the isoacceptor or isodecoder name, user can view the consensus based study results of all the tRNAs from the respective plant and isoacceptor/isodecoder.


PtRNAdb ID112156_PtRNAdb
Plant SourceRosa chinensis     |     Phanerogamae -->Dicot
Genome levelPlastid
tRNA IDchl.trna22
tRNA locuschl : 115093 - 115020 (-)
IsoacceptorMet

[NOTE: User can view the results of the consensus based study of all the tRNAs of Met isoacceptor in Rosa_chinensis plant by clicking on the isoacceptor]

IsodecoderCAT

[NOTE: User can view the results of the consensus based study of all the tRNAs of CAT isodecoder in Rosa_chinensis plant by clicking on the isodecoder]

tRNA Sequence
GCATCCATGGCTGAATGGTTAAAGCGCCCAACTCATAATTGGCGAATTCGTAGGTTCAATTCCTACTGGATGCA
tRNA secondary structure
>>>>>>>..>>>..........<<<.>>>>>.......<<<<.<.....>>>>>.......<<<<<<<<<<<<.
Upstream sequence (upto 100nt)
ATGCCCTTTCATTGAGTCCTCCTAAATTGCATTGATTTATCCTAAAGATTTCATTTCAATTGGAATTTGGTTATTCACCATGTACGAGGATCCCCGCTAA
Downstream sequence (upto 100nt)
CGCCAATGGGACCCTCCAATAAGTCTATTGGAATTGGCTCTGTATCAATGGAATCTCATCATCCATACATAACGAATTGGTGTGGTATATTCATATCATA
Mature tRNA
GCAUCCAUGGCUGAAUGGUUAAAGCGCCCAACUCAUAAUUGGCGAAUUCGUAGGUUCAAUUCCUACUGGAUGCA
HMM Score43.60
Secondary structure Score26.80