Detailed information



This page of PtRNAdb provides more detailed information about individual tRNA present in the database. Further, by clicking on the isoacceptor or isodecoder name, user can view the consensus based study results of all the tRNAs from the respective plant and isoacceptor/isodecoder.


PtRNAdb ID112084_PtRNAdb
Plant SourceQuercus lobata     |     Phanerogamae -->Dicot
Genome levelPlastid
tRNA IDchl.trna1
tRNA locuschl : 11779 - 11850 (+)
IsoacceptorArg

[NOTE: User can view the results of the consensus based study of all the tRNAs of Arg isoacceptor in Quercus_lobata plant by clicking on the isoacceptor]

IsodecoderTCT

[NOTE: User can view the results of the consensus based study of all the tRNAs of TCT isodecoder in Quercus_lobata plant by clicking on the isodecoder]

tRNA Sequence
GCGTCCATTGTCTAATGGATAGGACAGAGGTCTTCTAAACCTTTAGTATAGGTTCAAATCCTATTGGACGCG
tRNA secondary structure
>>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
Upstream sequence (upto 100nt)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGATGTGAAAACAAAACTAAGAAAAAA
Downstream sequence (upto 100nt)
ACGGATTTCCATATATTTCTTTTCTACTAACTAGGTATTTTGAATGATTTGAACAAGAGACCCTTATACTTATTTATATATTTATTTATATATTTATTCT
Mature tRNA
GCGUCCAUUGUCUAAUGGAUAGGACAGAGGUCUUCUAAACCUUUAGUAUAGGUUCAAAUCCUAUUGGACGCG
HMM Score36.80
Secondary structure Score28.60