Detailed information



This page of PtRNAdb provides more detailed information about individual tRNA present in the database. Further, by clicking on the isoacceptor or isodecoder name, user can view the consensus based study results of all the tRNAs from the respective plant and isoacceptor/isodecoder.


PtRNAdb ID111755_PtRNAdb
Plant SourceOryza meridionalis     |     Phanerogamae -->Monocot
Genome levelPlastid
tRNA IDchl.trna17
tRNA locuschl : 131939 - 132012 (+)
IsoacceptorMet

[NOTE: User can view the results of the consensus based study of all the tRNAs of Met isoacceptor in Oryza_meridionalis plant by clicking on the isoacceptor]

IsodecoderCAT

[NOTE: User can view the results of the consensus based study of all the tRNAs of CAT isodecoder in Oryza_meridionalis plant by clicking on the isodecoder]

tRNA Sequence
GCATCCATGGCTGAATGGTTAAAGCGCCCAACTCATAATTGGTAAATTTGCGGGTTCAATTCCTGCTGGATGCA
tRNA secondary structure
>>>>>>>..>>>..........<<<..>>>>.......<<<<.......>>>>>.......<<<<<<<<<<<<.
Upstream sequence (upto 100nt)
CGAATATTTGCCATCTCCGAATATTTTCGATTTCATTTTTCTATGATATGTCTTTCTATATGAAAATTGGTTATTTACGATGTACGATGATCCCTGTTAA
Downstream sequence (upto 100nt)
CGCGAACCGGAACGTTCCATAAGTCTATTGGAACTGGCTCTCTATCCATGGAATCTCATCCATCATCCATACATAACGAATTGGTATGGTATATTCATAC
Mature tRNA
GCAUCCAUGGCUGAAUGGUUAAAGCGCCCAACUCAUAAUUGGUAAAUUUGCGGGUUCAAUUCCUGCUGGAUGCA
HMM Score46.00
Secondary structure Score19.40