Detailed information



This page of PtRNAdb provides more detailed information about individual tRNA present in the database. Further, by clicking on the isoacceptor or isodecoder name, user can view the consensus based study results of all the tRNAs from the respective plant and isoacceptor/isodecoder.


PtRNAdb ID111742_PtRNAdb
Plant SourceOryza longistaminata     |     Phanerogamae -->Monocot
Genome levelPlastid
tRNA IDchl.trna4
tRNA locuschl : 15765 - 15848 (+)
IsoacceptorTyr

[NOTE: User can view the results of the consensus based study of all the tRNAs of Tyr isoacceptor in Oryza_longistaminata plant by clicking on the isoacceptor]

IsodecoderGTA

[NOTE: User can view the results of the consensus based study of all the tRNAs of GTA isodecoder in Oryza_longistaminata plant by clicking on the isodecoder]

tRNA Sequence
GGGTCGATGCCCGAGCGGTTAATGGGGACGGACTGTAAATTCGTTGACAATATGTCTACGCTGGTTCAAATCCAGCTCGGCCCA
tRNA secondary structure
>>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.>>>>...<<<<...>>>>>.......<<<<<<<<<<<<.
Upstream sequence (upto 100nt)
TTCAAGGAGGCAGCGGGGATTCGACTTCCCCTGGGGGTAGGGAGTATTATGAAAGGAGGTTAATCATAGATTATCAAAAACCCTAGAATAAATTCTTCCT
Downstream sequence (upto 100nt)
AAAATCTAGGGCTTCGTGAATATGAGTTAAATCCATTTTTTTTCTTCCATAAAAAAGAATATTTGATCCATAGAAATAAAAGAAATAAAGGATAAAAAGA
Mature tRNA
GGGUCGAUGCCCGAGCGGUUAAUGGGGACGGACUGUAAAUUCGUUGACAAUAUGUCUACGCUGGUUCAAAUCCAGCUCGGCCCA
HMM Score39.90
Secondary structure Score25.60