Detailed information



This page of PtRNAdb provides more detailed information about individual tRNA present in the database. Further, by clicking on the isoacceptor or isodecoder name, user can view the consensus based study results of all the tRNAs from the respective plant and isoacceptor/isodecoder.


PtRNAdb ID110270_PtRNAdb
Plant SourceBrassica nigra     |     Phanerogamae -->Dicot
Genome levelPlastid
tRNA IDchl.trna29
tRNA locuschl : 30288 - 30216 (-)
IsoacceptorGlu

[NOTE: User can view the results of the consensus based study of all the tRNAs of Glu isoacceptor in Brassica_nigra plant by clicking on the isoacceptor]

IsodecoderTTC

[NOTE: User can view the results of the consensus based study of all the tRNAs of TTC isodecoder in Brassica_nigra plant by clicking on the isodecoder]

tRNA Sequence
GCCCCCATCGTCTAGTGGTTCAGGACATCTCTCTTTCAAGGAGGCAGCGGGGATTCGACTTCCCCTGGGGGTA
tRNA secondary structure
>>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
Upstream sequence (upto 100nt)
AGAAAAAATCTTATAAGCTAGTCATACCATTTGATTATATTGACAATTTTAAAAAACTGATCATACTATGATCATAGTATGATGGCGGTTGAGCAAGTAT
Downstream sequence (upto 100nt)
GGGTACTACGAAAGGAAGTTGATCATGGATTATCCATAAAGTTAGAATAGATTCTTCCTGGGTCGATGCCCGAGCGGTTAATGGGGACGGACTGTAAATT
Mature tRNA
GCCCCCAUCGUCUAGUGGUUCAGGACAUCUCUCUUUCAAGGAGGCAGCGGGGAUUCGACUUCCCCUGGGGGUA
HMM Score28.90
Secondary structure Score25.00
[:(]