Detailed information



This page of PtRNAdb provides more detailed information about individual tRNA present in the database. Further, by clicking on the isoacceptor or isodecoder name, user can view the consensus based study results of all the tRNAs from the respective plant and isoacceptor/isodecoder.


PtRNAdb ID109268_PtRNAdb
Plant SourceZiziphus jujuba     |     Phanerogamae -->Dicot
Genome levelNuclear
tRNA IDchr-11.trna58
tRNA locuschr-11 : 20363225 - 20363152 (-)
IsoacceptorPro

[NOTE: User can view the results of the consensus based study of all the tRNAs of Pro isoacceptor in Ziziphus_jujuba plant by clicking on the isoacceptor]

IsodecoderTGG

[NOTE: User can view the results of the consensus based study of all the tRNAs of TGG isodecoder in Ziziphus_jujuba plant by clicking on the isodecoder]

tRNA Sequence
AGGGATGTAGCGTAGATTGGTAGCATGTTTGTTTTGGGTACAAAATTTCACGGGTTCAAATCCTGTCATCCCTA
tRNA secondary structure
>>>>>>>..>.>>.........<<.<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
Upstream sequence (upto 100nt)
AAGAAGAAATAGCAAGATAGTTTATGTATATTAATGGAAGAAATAAAGAAGTGGAAAACAAGACAGAGATTCTTTACAATGACACTGTAGGCCAATTGAA
Downstream sequence (upto 100nt)
CCTATTACTTATGGGCAGTAACAAGGGATCAATTGAAATTGATTAAAATTGGATTTACTTAATCCAGGATGTGTTATGTATATGCCATTTCGAAGTGGTC
Mature tRNA
AGGGAUGUAGCGUAGAUUGGUAGCAUGUUUGUUUUGGGUACAAAAUUUCACGGGUUCAAAUCCUGUCAUCCCUA
HMM Score18.90
Secondary structure Score20.70