Detailed information



This page of PtRNAdb provides more detailed information about individual tRNA present in the database. Further, by clicking on the isoacceptor or isodecoder name, user can view the consensus based study results of all the tRNAs from the respective plant and isoacceptor/isodecoder.


PtRNAdb ID107035_PtRNAdb
Plant SourceVitis riparia     |     Phanerogamae -->Dicot
Genome levelNuclear
tRNA IDchr-15.trna1
tRNA locuschr-15 : 1669779 - 1669861 (+)
IsoacceptorTyr

[NOTE: User can view the results of the consensus based study of all the tRNAs of Tyr isoacceptor in Vitis_riparia plant by clicking on the isoacceptor]

IsodecoderGTA

[NOTE: User can view the results of the consensus based study of all the tRNAs of GTA isodecoder in Vitis_riparia plant by clicking on the isodecoder]

tRNA Sequence
A-Box B-Box
CCGGCTTTAGCTCAGTTGGTAGAGCGGAGGACTGTAGTATGGCTGTGATCCTTAGGTCGCTGGTTCGAATCCGGCAAGCCGGA
tRNA secondary structure
>>>>>>>..>>>>........<<<<.>>>>>.................<<<<<.....>>>>>.......<<<<<<<<<<<<.
Upstream sequence (upto 100nt)
TGTTTGATAATATTTTTATTCAAAATATTTTGATGAGAATTACTTCATCATGCCAAACAGACTCTTATTTATATATCTTCTGATGAAACACAAAACAACA
Downstream sequence (upto 100nt)
TCCTTTTTCTCCTTTTTAGTTTTTACCCTATAAAAACGGCGTCGTTTTACTATTTCTTTTTTATAATATATATATTTTACTGACAAAATTATTTATAAAA
Mature tRNA
CCGGCUUUAGCUCAGUUGGUAGAGCGGAGGACUGUAGAUCCUUAGGUCGCUGGUUCGAAUCCGGCAAGCCGGA
Intron Sequence
TATGGCTGTG
Intron Position38-47
Infernal Score75.3
HMM Score44.10
Secondary structure Score31.20