Detailed information



This page of PtRNAdb provides more detailed information about individual tRNA present in the database. Further, by clicking on the isoacceptor or isodecoder name, user can view the consensus based study results of all the tRNAs from the respective plant and isoacceptor/isodecoder.


PtRNAdb ID103852_PtRNAdb
Plant SourceTriticum urartu     |     Phanerogamae -->Monocot
Genome levelNuclear
tRNA IDchr-5.trna344
tRNA locuschr-5 : 422374796 - 422374725 (-)
IsoacceptorAsp

[NOTE: User can view the results of the consensus based study of all the tRNAs of Asp isoacceptor in Triticum_urartu plant by clicking on the isoacceptor]

IsodecoderGTC

[NOTE: User can view the results of the consensus based study of all the tRNAs of GTC isodecoder in Triticum_urartu plant by clicking on the isodecoder]

tRNA Sequence
GTCGTTGTAGTATAGTGGTAAGTATTCCCACTTGTCACGTGGGTGACCCGGGTTTGATCCTCGGCAACGGCG
tRNA secondary structure
>>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
Upstream sequence (upto 100nt)
GATCTCCGGGCTGTCCACGAGACAGGGGGGCGCGCCCCCACCCTCATGGGCAGCCCGGTACTCTCTTGGTCCATCTCCGATACTCCGTGGGCTTCTTCTA
Downstream sequence (upto 100nt)
CCAGAAATCCTTCTTGCTACCTCTTGAGAACTGCGTTGGTTTTCCCTTGAAGAGGAAAGGGTGATGCAGCAGAGCAGCGTAAGTATTTCCCTTAGTTTTT
Mature tRNA
GUCGUUGUAGUAUAGUGGUAAGUAUUCCCACUUGUCACGUGGGUGACCCGGGUUUGAUCCUCGGCAACGGCG
HMM Score26.50
Secondary structure Score22.00