| CoNCRAtlas ID | CoMIRGB063 |
|---|---|
| Mature miRNA sequence | UCGGACCAGGCUUCAUUCCCc |
| Locus | D02:66409665-66409852(+) |
| Alignment | Displayed Location: CM018216.1:66409653-66409779 Strand: +
GAAAUGGGUUGUCUUUGAGAGGAAUGUUGGCUGGCUCGAUGCGACAGCUUUGAGAUUGUAAAGUGUGAUCAAAGUAAAAGGUAUCAUCGGACCAGGCUUCAUUCCCCUCAAACAUUUUCAUUUUUAA
((((((.......((((((.((((((..(.((((.((((((..((.(((((((...............))))))).....))..)))))).)))).)..)))))).)))))))))))))))).....
......................................................................................UCGGACCAGGCUUCAUUCCCC.................... gba-miR166g
....................GGAAUGUUGGCUGGCUCGAUG...................................................................................... gba-miR166g*
|
| miRNA family | miR166 |
Expression profile
| Tissue specificity index | Ovule: 0.0715; root: 0.2448; shoot apical: 0.3558; fiber: 0.0347; all tissues: 0.2931 | Tau: 0.5475 |
|---|
Additional Information
Overlapping Elements:
| Target lncRNA | CoLNCGB27758, CoLNCGB27758, CoLNCGB08918, CoLNCGB23404, CoLNCGB23405, CoLNCGB28882, CoLNCGB27758, CoLNCGB27695, CoLNCGB09188, CoLNCGB09187 |
|---|
| Target CDS | GB_A05G1336, GB_D05G1338, GB_A13G1526, GB_A02G0792, GB_A06G0949, GB_A12G0899, GB_A05G0479, GB_A05G1054, GB_A06G1038, GB_A08G2365 |
|---|
| sORF |
|---|
| Reference | |
|---|---|
| PMID | Title |
| 25131375 | Small RNA and degradome profiling reveals a role for miRNAs and their targets in the developing fibers of Gossypium barbadense |