| CoNCRAtlas ID | CoMIRGH211 |
|---|---|
| Mature miRNA sequence | UGGUGUGCAGGGGGUGGAAUA |
| Locus | D11:23431808-23431877(-) |
| Alignment | Displayed Location: D11:23431796-23431896 Strand: - UGACAUGGGUUUAUGUUAUAUUCCAUCUCUUGCACACUGGACAAGUGCUGGGCUUCAGGCUGGUGUGCAGGGGGUGGAAUAUAUCAUUGAAUCAUGAUGUU .)).))))))..(((.((((((((((((((((((((((((..((((.....))))....)))))))))))))))))))))))).)))......))))))). ............................................................UGGUGUGCAGGGGGUGGAAUA.................... ghi-miR2950b ....................UUCCAUCUCUUGCACACUGGA............................................................ ghi-miR2950b* |
| miRNA family | miR2950 |
Expression profile
| Tissue specificity index | ovule: 0.0001; fiber: 0.0269; shoot apical: 0.6315; ovule and fiber: 0.0001; cotton boll: 0.0004; callus: 0.0006; leaf: 0.0912; anthers: 0.0307; hypocotyls: 0.2183; seedlings: 0.0002 | Tau: 0.9416 |
|---|
Additional Information
Overlapping Elements:
| Target lncRNA | CoLNCGH17943, CoLNCGH17944, CoLNCGH17945, CoLNCGH01757, CoLNCGH42850, CoLNCGH42851, CoLNCGH42852, CoLNCGH34604, CoLNCGH34605, CoLNCGH01756 |
|---|
| Target CDS | Gh_A13G214300.1, Gh_D13G217600.1, Gh_D05G039500.1, Gh_A07G036000.1, Gh_D11G305500.1, Gh_A12G073200.1, Gh_D12G073000.1, Gh_A07G032300.1, Gh_A07G032300.2, Gh_D07G033700.1 |
|---|
| sORF |
|---|
| Reference | |
|---|---|
| PMID | Title |
| 29481843 | MicroRNA-target gene responses to root knot nematode (Meloidogyne incognita) infection in cotton (Gossypium hirsutum L.) |