| CoNCRAtlas ID | CoMIRGH207 |
|---|---|
| Mature miRNA sequence | UGAAGCUGCCAGCAUGAUCUAA |
| Locus | D11:12512848-12512924(+) |
| Alignment | Displayed Location: D11:12512829-12512938 Strand: + GGCGUGAACCUACAAGCAGUUGAAGCUGCCAGCAUGAUCUAAACUUCCUUCUCUGUUGAGGGAUAGAUGGGAUCAUGUGGUAGCUUCACCUGUUGUUGGGAUCACGAGCU ..(((((.((((..(((((.(((((((((((.((((((((...((((((((......)))))).))...))))))))))))))))))).)))))..)))).)))))..)) ....................UGAAGCUGCCAGCAUGAUCUAA.................................................................... ghi-miR167g .....................................................................GGAUCAUGUGGUAGCUUCACC.................... ghi-miR167g* |
| miRNA family | miR167 |
Expression profile
| Tissue specificity index | ovule: 0.0154; fiber: 0.0301; shoot apical: 0.3671; ovule and fiber: 0.0325; cotyledon: 0.0054; cotton boll: 0.0026; callus: 0.0065; leaf: 0.3921; anthers: 0.0289; hypocotyls: 0.1128; seedlings: 0.0066 | Tau: 0.845 |
|---|
Additional Information
Overlapping Elements:
| Target lncRNA | CoLNCGH06214, CoLNCGH28913, CoLNCGH28914, CoLNCGH06213, CoLNCGH16993, CoLNCGH16994, CoLNCGH46236, CoLNCGH46237, CoLNCGH06553, CoLNCGH06554 |
|---|
| Target CDS | Gh_D02G245400.1, Gh_A03G228800.1, Gh_A13G097700.1, Gh_D13G105200.1, Gh_A06G203700.1, Gh_D06G208800.1, Gh_D06G208800.2, Gh_D09G091900.1, Gh_A05G064500.1, Gh_D05G079000.1 |
|---|
| sORF |
|---|
| Reference | |
|---|---|
| PMID | Title |
| 22160515 | Difference in miRNA expression profiles between two cotton cultivars with distinct salt sensitivity |