| CoNCRAtlas ID |
CoMIRGH201 |
|---|
| Mature miRNA sequence |
UUUGUUUAUGGUCAUCUAAGC |
|---|
| Locus |
D10:59025402-59025529(+) |
|---|
| Alignment |
Displayed Location: D10:59025388-59025548 Strand: +
AAAAUGCAUUGUUGAAUGUGUUUGUUUAUGGUCAUCUAAGCCAUUUUUCAUCUCGCCAAUUCUUUGUUCAAGCAGUUUUUGGAUAAUCGAACCGAUAGACUACACCCGCAGAAAUGAUGUUUAGAUGACCAUCAACAAACAACUUCAUCUUAUUGCAUCAA
...(((((..(.((((..((((((((.((((((((((((((((((((((......((((....((((....))))...))))...((((...))))...........).)))))))..)))))))))))))).))))))))..)))).)....)))))...
....................UUUGUUUAUGGUCAUCUAAGC........................................................................................................................ ghi-miR827b
........................................................................................................................UUAGAUGACCAUCAACAAACA.................... ghi-miR827b*
|
|---|
| miRNA family |
miR827 |
|---|
Expression profile
| Tissue specificity index | ovule: 0.0349; fiber: 0.0073; shoot apical: 0.0074; ovule and fiber: 0.017; cotyledon: 0.296; cotton boll: 0.0049; callus: 0.059; leaf: 0.3058; anthers: 0.0013; hypocotyls: 0.0062; seedlings: 0.2602 | Tau: 0.773
|
|---|
| Tissue |
|
|---|
| Developmental Stage |
|
|---|
| Treatment |
|
|---|
Additional Information
Overlapping Elements:
Reference
| PMID |
Title |
|---|
| 29481843 | MicroRNA-target gene responses to root knot nematode (Meloidogyne incognita) infection in cotton (Gossypium hirsutum L.) |