| CoNCRAtlas ID |
CoMIRGH196 |
| Mature miRNA sequence |
UUGUCGCAGGAGAGAUGGCACU |
| Locus |
D09:6762863-6762954(-) |
| Alignment |
Displayed Location: D09:6762846-6762974 Strand: -
AAGAGGAGGUUGGGGGAAUCUUGUCGCAGGAGAGAUGGCACUGAGGGUUUUAUAUAUGAUUUGCUUCCCCCACCCUAGCUUAGCUUAGUGCCGUCGUCUUGUGACAAGAUACCCUUCAAUUUCUCUGUU
.((((.((((((((((.((((((((((((((..((((((((((((((((........((......)).........))))...)))))))))))).)))))))))))))).))).)))))))))))...
....................UUGUCGCAGGAGAGAUGGCACU....................................................................................... ghi-miR3627c
........................................................................................UGCCGUCGUCUUGUGACAAGA.................... ghi-miR3627c*
|
| miRNA family |
miR3627 |
Expression profile
| Tissue specificity index | ovule: 0.0133; fiber: 0.0033; shoot apical: 0.6091; ovule and fiber: 0.0018; cotyledon: 0.0833; cotton boll: 0.0012; callus: 0.0008; leaf: 0.1473; anthers: 0.0904; hypocotyls: 0.0004; seedlings: 0.0491 | Tau: 0.9358
|
| Tissue |
|
| Developmental Stage |
|
| Treatment |
|
Additional Information
Overlapping Elements:
| Chromosome | Start | End | Strand | Molecule |
| D09 | 6762149 | 6763064 | - | CoLNCGH10969 |
Reference
| PMID |
Title |
|---|
| 25572837 | Small RNA sequencing identifies miRNA roles in ovule and fibre development |