| CoNCRAtlas ID | CoMIRGH190 |
|---|---|
| Mature miRNA sequence | UGAAGCUGCCAGCAUGAUCUCA |
| Locus | D09:50213732-50213921(+) |
| Alignment | Displayed Location: D09:50213811-50213922 Strand: + UAUGGUGCUCCAACAUCAGAUGAAGCUGCCAGCAUGAUCUCAAUUUCCCUCUGUUUUAUCGAGGAAAAAUCAGAUCAUGUGGCAGUUUCACCUGUUGCUGCUUGCACCCCCA )..(((((..((.((.(((.(((((((((((.((((((((...(((.((((.........)))).)))...))))))))))))))))))).))).)).))...))))).))) ....................UGAAGCUGCCAGCAUGAUCUCA...................................................................... ghi-miR167e .......................................................................AGAUCAUGUGGCAGUUUCACC.................... ghi-miR167e* |
| miRNA family | miR167 |
Expression profile
| Tissue specificity index | ovule: 0.0869; fiber: 0.1419; shoot apical: 0.0444; ovule and fiber: 0.4395; cotyledon: 0.0023; cotton boll: 0.0156; callus: 0.0003; leaf: 0.0167; anthers: 0.2474; hypocotyls: 0.0029; seedlings: 0.0021 | Tau: 0.8724 |
|---|
Additional Information
Overlapping Elements:
| Target lncRNA | CoLNCGH06214, CoLNCGH28913, CoLNCGH28914, CoLNCGH06213, CoLNCGH06553, CoLNCGH06554, CoLNCGH06555, CoLNCGH06556, CoLNCGH06557, CoLNCGH06558 |
|---|
| Target CDS | Gh_A06G203700.1, Gh_D06G208800.1, Gh_D06G208800.2, Gh_D09G091900.1, Gh_A02G146600.1, Gh_A02G146600.2, Gh_D03G081200.1, Gh_D13G114900.1, Gh_A02G013100.1, Gh_A04G062800.2 |
|---|
| sORF |
|---|
| Reference | |
|---|---|
| PMID | Title |
| 22160515 | Difference in miRNA expression profiles between two cotton cultivars with distinct salt sensitivity |