| CoNCRAtlas ID | CoMIRGH130 |
|---|---|
| Mature miRNA sequence | UUGGACAGAGUAAUCACGGUCG |
| Locus | D02:5144221-5144376(-) |
| Alignment | Displayed Location: D02:5144205-5144322 Strand: - UUCAGAUCCGGUCCAUUUGCUUGGACAGAGUAAUCACGGUCGAUUUCUGUUUAGCACAACAGGUUUCGUUUAAAUCAAUCGUGUUACUCCGUCCAAACAGAUGUUUUUGGAUCAUCGA ))..(((((((..((((((.((((((.((((((.(((((((((..((((((......))))))..))).........)))))))))))).)))))).))))))...)))))))...(( ....................UUGGACAGAGUAAUCACGGUCG............................................................................ ghi-miR3954b .............................................................................AUCGUGUUACUCCGUCCAAAC.................... ghi-miR3954b* |
| miRNA family | miR3954 |
Expression profile
| Tissue specificity index | ovule: 0.0184; fiber: 0.0168; shoot apical: 0.3832; ovule and fiber: 0.4282; cotyledon: 0.0013; cotton boll: 0.0074; callus: 0.0127; leaf: 0.0672; anthers: 0.0632; seedlings: 0.0015 | Tau: 0.8665 |
|---|
Additional Information
Overlapping Elements:
| Target lncRNA | CoLNCGH12632, CoLNCGH12633, CoLNCGH12634, CoLNCGH52597, CoLNCGH00870, CoLNCGH42754, CoLNCGH00869, CoLNCGH00867, CoLNCGH00868, CoLNCGH41885 |
|---|
| Target CDS | Gh_A02G011500.1, Gh_D02G012500.1, Gh_A02G074300.1, Gh_A02G183500.1, Gh_D03G028800.1, Gh_D12G095500.1, Gh_D02G077400.1, Gh_D01G194200.1, Gh_A05G069500.1, Gh_A05G069500.2 |
|---|
| sORF |
|---|
| Reference | |
|---|---|
| PMID | Title |
| 25371507 | Deep sequencing reveals important roles of microRNAs in response to drought and salinity stress in cotton |