| CoNCRAtlas ID | CoMIRGH124 |
|---|---|
| Mature miRNA sequence | CUGAAGUGUUUGGGGGAACUC |
| Locus | D01:63540632-63540707(-) |
| Alignment | Displayed Location: D01:63540619-63540727 Strand: - UAUGCCAGGUGCCCACUAGAGUUCCCUCAUGCACUUCAGUUUAUUUGUCAAAACUUCUUUGCUGUUUACUGAAGUGUUUGGGGGAACUCCGGUUGCCAUCUGAGAUGGU (((.....)))))).)).(((((((((((.((((((((((..((..(.((((.....))))).))..)))))))))).)))))))))))..(((((((((...)))))) ....................................................................CUGAAGUGUUUGGGGGAACUC.................... ghi-miR395d ....................GUUCCCUCAUGCACUUCAGUU.................................................................... ghi-miR395d* |
| miRNA family | miR395 |
Expression profile
| Tissue specificity index | ovule: 0.0348; fiber: 0.6378; shoot apical: 0.025; ovule and fiber: 0.0242; cotyledon: 0.0233; cotton boll: 0.1862; callus: 0.0035; leaf: 0.0122; anthers: 0.0283; seedlings: 0.0246 | Tau: 0.9432 |
|---|
Additional Information
Overlapping Elements:
| Target lncRNA | CoLNCGH51706, CoLNCGH01290, CoLNCGH18451, CoLNCGH01289, CoLNCGH05362, CoLNCGH07996, CoLNCGH07945, CoLNCGH07944, CoLNCGH43807, CoLNCGH43808 |
|---|
| Target CDS | Gh_A13G153900.1, Gh_D13G156900.1, Gh_D11G276200.1, Gh_D03G096300.1, Gh_D09G053600.1, Gh_A09G057300.1, Gh_A12G123200.1, Gh_A01G135900.1, Gh_A01G066200.1, Gh_A03G133100.1 |
|---|
| sORF |
|---|
| Reference | |
|---|---|
| PMID | Title |
| 25371507 | Deep sequencing reveals important roles of microRNAs in response to drought and salinity stress in cotton |