| CoNCRAtlas ID |
CoMIRGH100 |
|---|
| Mature miRNA sequence |
UGAAGCUGCCAGCAUGAUCUA |
|---|
| Locus |
A12:364060-364158(-) |
|---|
| Alignment |
Displayed Location: A12:364045-364173 Strand: -
GAAGUCUGCAAGGGAAAAAGUGAAGCUGCCAGCAUGAUCUAUCUUCGGUUAGUAAGAUGCGGAUGCUAUAUUGCUAACCCUAGCUAGGUCAUGCUGCGACAGCCUCACUCCUUCCUACUUGGGGCCCAA
).)))).))..(((((..(((((.(((((((((((((((((.((..(((((((((...((....))....)))))))))..)).)))))))))))).).)))).)))))..)))))..((((((.....
....................UGAAGCUGCCAGCAUGAUCUA........................................................................................ ghi-miR167b
......................................................................................GGUCAUGCUGCGACAGCCUCACU.................... ghi-miR167b*
|
|---|
| miRNA family |
miR167 |
|---|
Expression profile
| Tissue specificity index | ovule: 0.0007; fiber: 0.0181; shoot apical: 0.6596; ovule and fiber: 0.1369; cotyledon: 0.0005; cotton boll: 0.0026; callus: 0.0002; leaf: 0.0066; anthers: 0.0389; hypocotyls: 0.1351; seedlings: 0.0009 | Tau: 0.9484
|
|---|
| Tissue |
|
|---|
| Developmental Stage |
|
|---|
| Treatment |
|
|---|
Additional Information
Overlapping Elements:
| Chromosome | Start | End | Strand | Molecule |
|---|
| A12 | 363402 | 364929 | - | CoLNCGH42265 |
Reference
| PMID |
Title |
|---|
| 29481843 | MicroRNA-target gene responses to root knot nematode (Meloidogyne incognita) infection in cotton (Gossypium hirsutum L.) |