| CoNCRAtlas ID | CoMIRGH095 |
|---|---|
| Mature miRNA sequence | CGAGCCGAAUCAAUAUCACUC |
| Locus | A12:102973572-102973689(+) |
| Alignment | Displayed Location: A12:102973595-102973700 Strand: + GUGGGAGGAGUAGACACGACGUGAUAUUGGUUCGGCUCAUCUUAUUGUGAUUAAAAAUUUCAAGGCGAGCCGAAUCAAUAUCACUCAUGUAUGCUUUUUUAUUAUU )).)))))((((.(((.((.((((((((((((((((((.((((...((........))...)))).)))))))))))))))))))).))).))))........... .................................................................CGAGCCGAAUCAAUAUCACUC.................... ghi-miR171e ....................GUGAUAUUGGUUCGGCUCAUC................................................................. ghi-miR171e* |
| miRNA family | miR171 |
Expression profile
| Tissue specificity index | ovule: 0.0058; fiber: 0.0319; shoot apical: 0.0473; ovule and fiber: 0.0024; cotton boll: 0.0046; callus: 0.0004; leaf: 0.0561; anthers: 0.017; hypocotyls: 0.8345 | Tau: 0.9802 |
|---|
Additional Information
Overlapping Elements:
| Target lncRNA | CoLNCGH44504, CoLNCGH44504, CoLNCGH29016, CoLNCGH02014, CoLNCGH36571, CoLNCGH36570, CoLNCGH36569, CoLNCGH36568, CoLNCGH12978, CoLNCGH06349 |
|---|
| Target CDS | Gh_A06G047700.1, Gh_D06G047200.1, Gh_D05G234400.1, Gh_A05G217600.1, Gh_A02G199300.1, Gh_D05G015600.1, Gh_D10G064300.1, Gh_A10G050700.1, Gh_D13G239700.1, Gh_D04G135400.1 |
|---|
| sORF |
|---|
| Reference | |
|---|---|
| PMID | Title |
| 29481843 | MicroRNA-target gene responses to root knot nematode (Meloidogyne incognita) infection in cotton (Gossypium hirsutum L.) |