CoNCRAtlas ID |
CoMIRGH073 |
Mature miRNA sequence |
UUUGUUUAUGGUCAUCUAAGC |
Locus |
A10:107674538-107674666(+) |
Alignment |
Displayed Location: A10:107674526-107674686 Strand: +
AAAAUGCAUUAUUGAAUGUGUUUGUUUAUGGUCAUCUAAGCCAUUUUUCAUCUCGCCAAUUCUUUGUUCAAGCAGUUUUUGGAUAAUCGAACCGAUAGAAUACACCCGCAGAAAUGAUGUUUAGAUGACCAUCAACAAACAACUUCAUCUUAUUGCAUCAA
...(((((.((.((((..((((((((.(((((((((((((((((((((..........((((((((((((((.....)))))))))..........)))))........)))))))..)))))))))))))).))))))))..))))...)).)))))...
....................UUUGUUUAUGGUCAUCUAAGC........................................................................................................................ ghi-miR827a
........................................................................................................................UUAGAUGACCAUCAACAAACA.................... ghi-miR827a*
|
miRNA family |
miR827 |
Expression profile
Tissue specificity index | ovule: 0.0135; fiber: 0.006; shoot apical: 0.0039; ovule and fiber: 0.0183; cotyledon: 0.2619; cotton boll: 0.0066; callus: 0.0565; leaf: 0.2506; anthers: 0.0038; hypocotyls: 0.0063; seedlings: 0.3724 | Tau: 0.8315
|
Tissue |
|
Developmental Stage |
|
Treatment |
|
Additional Information
Overlapping Elements:
Chromosome | Start | End | Strand | Molecule |
A10 | 107674199 | 107678196 | + | CoLNCGH38648 |
Reference
PMID |
Title |
---|
29481843 | MicroRNA-target gene responses to root knot nematode (Meloidogyne incognita) infection in cotton (Gossypium hirsutum L.) |