| CoNCRAtlas ID |
CoMIRGH043 |
|---|
| Mature miRNA sequence |
UUAAAGUAGAAAUAUAAGAAA |
|---|
| Locus |
A07:18368-18495(-) |
|---|
| Alignment |
Displayed Location: A07:18352-18511 Strand: -
AUCAUCUUCAACCAGUUCCGUCUUAUAUUUCUACUUUAACAAUAUUCUUAUUUUCUUCUUCGCCCGUUGGGUUUCUGUAUAAUUACACUAUUGUUGCCAAUCAGAACUUAUAAAUAUUGUUAAAGUAGAAAUAUAAGAAAAUAUUGUAUAAUUACACUUU
))))).......((((....((((((((((((((((((((((((((..((..((((.....((((...))))...((((....))))..((((....)))).))))..))..))))))))))))))))))))))))))....))))..............
.......................................................................................................................UUAAAGUAGAAAUAUAAGAAA.................... ghi-miR7502
....................UCUUAUAUUUCUACUUUAACA....................................................................................................................... ghi-miR7502*
|
|---|
| miRNA family |
miR7502 |
|---|
Expression profile
| Tissue specificity index | ovule: 0.1775; fiber: 0.012; shoot apical: 0.1897; ovule and fiber: 0.0542; cotyledon: 0.0167; cotton boll: 0.0718; callus: 0.056; leaf: 0.2965; anthers: 0.0979; hypocotyls: 0.0258; seedlings: 0.0019 | Tau: 0.7627
|
|---|
| Tissue |
|
|---|
| Developmental Stage |
|
|---|
| Treatment |
|
|---|
Additional Information
Overlapping Elements:
Reference
| PMID |
Title |
|---|
| 29481843 | MicroRNA-target gene responses to root knot nematode (Meloidogyne incognita) infection in cotton (Gossypium hirsutum L.) |