| CoNCRAtlas ID |
CoMIRGH031 |
|---|
| Mature miRNA sequence |
UGACAGAAGAGAGUGAGCAC |
|---|
| Locus |
A05:5639298-5639396(+) |
|---|
| Alignment |
Displayed Location: A05:5639284-5639405 Strand: +
CUUCUUUGGGACAUAGAAAUUGACAGAAGAGAGUGAGCACACAGAGGCACUUGUAUAAGGCUAUACUUCUGCUUUUGCGUGCUCACUUCUCUUUUUGUCAGUUUCCAGUGCCGGAAUUUGAU
......(((((((..(((((((((((((((((((((((((.((((((((...(((((....)))))...)))))))).)))))))).)))).)))))))))))))(((.(((((((..((((
....................UGACAGAAGAGAGUGAGCAC.................................................................................. ghi-miR157
................................................................................GCUCACUUCUCUUUUUGUCAGU.................... ghi-miR157*
|
|---|
| miRNA family |
miR157 |
|---|
Expression profile
| Tissue specificity index | fiber: 0.0002; shoot apical: 0.0651; cotyledon: 0.0042; callus: 0.0004; leaf: 0.0609; anthers: 0.0022; hypocotyls: 0.862; seedlings: 0.005 | Tau: 0.984
|
|---|
| Tissue |
|
|---|
| Developmental Stage |
|
|---|
| Treatment |
|
|---|
Additional Information
Overlapping Elements:
Reference
| PMID |
Title |
|---|
| 0 | Differential Expression of MicroRNAs Between 21A Genetic Male Sterile Line and Its Maintainer Line in Cotton (Gossypium hirsutum L.) |