| CoNCRAtlas ID | CoMIRGH028 |
|---|---|
| Mature miRNA sequence | AUUGAGUGCAGCGUUGAUGAA |
| Locus | A05:16355891-16355992(-) |
| Alignment | Displayed Location: A05:16355881-16355986 Strand: - CCCCGGAUGGAAGAAACAUCAUUGAGUGCAGCGUUGAUGAAAUUUCUCAAUUUCUGAGAUGAAUUCGUCAGCGCUGCUCUCAAUCAUGUUUUUUUCCUUUCGAGAA ...((((.(((((((((((.((((((.((((((((((((((...(((((.....)))))....)))))))))))))).)))))).))).)))))))).)))).... ....................AUUGAGUGCAGCGUUGAUGAA................................................................. ghi-miR397a .................................................................CGUCAGCGCUGCUCUCAAUCA.................... ghi-miR397a* |
| miRNA family | miR397 |
Expression profile
| Tissue specificity index | ovule: 0.0069; fiber: 0.2177; shoot apical: 0.0292; ovule and fiber: 0.0304; cotyledon: 0.1165; cotton boll: 0.0379; callus: 0.4798; leaf: 0.0465; anthers: 0.0239; hypocotyls: 0.0113 | Tau: 0.8916 |
|---|
Additional Information
Overlapping Elements:
| Target lncRNA | CoLNCGH13012, CoLNCGH25194, CoLNCGH28971, CoLNCGH48164, CoLNCGH48163, CoLNCGH48161, CoLNCGH48162, CoLNCGH13855, CoLNCGH48160, CoLNCGH48159 |
|---|
| Target CDS | Gh_A13G099700.1, Gh_D13G103500.1, Gh_A13G024900.1, Gh_D13G026700.1, Gh_D04G147100.1, Gh_A11G377400.1, Gh_D11G384900.1, Gh_A13G032800.1, Gh_A13G032900.1, Gh_A03G063500.1 |
|---|
| sORF |
|---|
| Reference | |
|---|---|
| PMID | Title |
| 22160515 | Difference in miRNA expression profiles between two cotton cultivars with distinct salt sensitivity |