| CoNCRAtlas ID | CoMIRGH002 |
|---|---|
| Mature miRNA sequence | CUGAAGUGUUUGGGGGAACUC |
| Locus | A01:114757546-114757644(-) |
| Alignment | Displayed Location: A01:114757536-114757644 Strand: - UAUGCCAGAUGCCCACUAGAGUUCCCUCCGGCACUUCAGUUUAUUUGUCAAAACUUCUUUGCUGUUUACUGAAGUGUUUGGGGGAACUCCGGUUGCCAUCUGAGAUGGU )))))((((((.(.(((.((((((((((.(((((((((((..((..(.((((.....))))).))..))))))))))).)))))))))).))).).)))))).(((((. ....................................................................CUGAAGUGUUUGGGGGAACUC.................... ghi-miR395a ....................GUUCCCUCCGGCACUUCAGUU.................................................................... ghi-miR395a* |
| miRNA family | miR395 |
Expression profile
| Tissue specificity index | ovule: 0.027; fiber: 0.3957; shoot apical: 0.0637; ovule and fiber: 0.0098; cotyledon: 0.0195; cotton boll: 0.2431; callus: 0.0022; leaf: 0.0951; anthers: 0.0668; hypocotyls: 0.0296; seedlings: 0.0476 | Tau: 0.8473 |
|---|
Additional Information
Overlapping Elements:
| Target lncRNA | CoLNCGH51706, CoLNCGH01290, CoLNCGH18451, CoLNCGH01289, CoLNCGH05362, CoLNCGH07996, CoLNCGH07945, CoLNCGH07944, CoLNCGH43807, CoLNCGH43808 |
|---|
| Target CDS | Gh_A13G153900.1, Gh_D13G156900.1, Gh_D11G276200.1, Gh_D03G096300.1, Gh_A02G082200.1, Gh_D09G053600.1, Gh_A09G057300.1, Gh_A12G123200.1, Gh_A01G135900.1, Gh_A01G066200.1 |
|---|
| sORF |
|---|
| Reference | |
|---|---|
| PMID | Title |
| 29481843 | MicroRNA-target gene responses to root knot nematode (Meloidogyne incognita) infection in cotton (Gossypium hirsutum L.) |