| CoNCRAtlas ID |
CoMIRGB092 |
|---|
| Mature miRNA sequence |
UUGACAGAAGAUAGAGAGCAC |
|---|
| Locus |
D09:23151189-23151301(+) |
|---|
| Alignment |
Displayed Location: CM018223.1:23151176-23151310 Strand: +
GAGGCAAUUGGUGAUUGUUGUUGACAGAAGAUAGAGAGCACAGAUGAUGGUGUGUAAUUAGGAGUCUUGAAGCAAUGCAUCCCACUCCUUUGUGCUCUUUAUGCUUCUGUCAUCACCUUCAAGCCACUCUUACCU
(((((....(((((.......(((((((((((((((((((((((.(((((.(((((.(((((...))))).....))))).))).)).)))))))))))))).)))))))))))))).....)))..))))..))
....................UUGACAGAAGAUAGAGAGCAC.............................................................................................. gba-miR157c
.............................................................................................GCUCUUUAUGCUUCUGUCAUCA.................... gba-miR157c*
|
|---|
| miRNA family |
miR157 |
|---|
Expression profile
| Tissue specificity index | Ovule: 0.0003; root: 0.4914; shoot apical: 0.4643; fiber: 0.0406; all tissues: 0.0034 | Tau: 0.7412
|
|---|
| Tissue |
|
|---|
| Developmental Stage |
|
|---|
| Treatment |
|
|---|
Additional Information
Overlapping Elements:
| Chromosome | Start | End | Strand | Molecule |
|---|
| D09 | 23150991 | 23153147 | + | CoLNCGB21494 |
Reference
| PMID |
Title |
|---|
| 25131375 | Small RNA and degradome profiling reveals a role for miRNAs and their targets in the developing fibers of Gossypium barbadense |