| CoNCRAtlas ID |
CoMIRGB085 |
|---|
| Mature miRNA sequence |
UGCCUGGCUCCCUGAAUGCCA |
|---|
| Locus |
D07:49785460-49785557(-) |
|---|
| Alignment |
Displayed Location: CM018221.1:49785442-49785576 Strand: -
AUGAAACAAUGGAAAUGAUCUGCCUGGCUCCCUGAAUGCCAACUAUGGAUGGUGUCAAAUAAGCGGUGUUCUGUUGUUGGCCCUUUCCUAGUUGGCAUCAGAGGACUCAGGCAGGUCUAUCCUUUUUAUCAUCUU
((((......(((...(((((((((((.(((((((.(((((((((.(((.((.(((((...(((((....))))).)))))))..)))))))))))))))).))).)))))))))))..)))......)))))))
....................UGCCUGGCUCCCUGAAUGCCA.............................................................................................. gba-miR160
..............................................................................................GCAUCAGAGGACUCAGGCAGG.................... gba-miR160*
|
|---|
| miRNA family |
miR160 |
|---|
Expression profile
| Tissue specificity index | Ovule: 0.0672; root: 0.542; shoot apical: 0.1587; fiber: 0.1414; all tissues: 0.0908 | Tau: 0.7887
|
|---|
| Tissue |
|
|---|
| Developmental Stage |
|
|---|
| Treatment |
|
|---|
Additional Information
Overlapping Elements:
Reference
| PMID |
Title |
|---|
| 31620865 | Analysis of the MIR160 gene family and the role of MIR160a_A05 in regulating fiber length in cotton |