PVsiRNAdb Id Plant Scientific Name Virus Virus Name PMID Tissue Sequence PVsiRNA-228185 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 Leaves and Stems AAGAGACUUAAGUAAAACCACU PVsiRNA-228186 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UGUUUCUCAGUUCUGAACGAGU PVsiRNA-228187 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CUCAACUGUGCUCGUUGGUAGU PVsiRNA-228188 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UUCUUUGGAUGAGAAAGACGGA PVsiRNA-228189 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UACGAACAGGACCUAGCUGAGU PVsiRNA-228190 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CACACUGUAAACUCAAUUCACU PVsiRNA-228191 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UUCCAGUCCCGGAAGGAACGUG PVsiRNA-228192 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 AGAGGAGCUGAUCCAGAACGGU PVsiRNA-228193 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UUUCUUUGGAUGAGAAAGACGG PVsiRNA-228194 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UUUGUUAAUCGUUGAGGAGAGU PVsiRNA-228195 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UUUGUUAAUCGUUGAGGAGAGU PVsiRNA-228196 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UUUGUUAAUCGUUGAGGAGAGU PVsiRNA-228197 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CGUGAUGAUGGUGAACUCAUG PVsiRNA-228198 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CGUGAUGAUGGUGAACUCAUG PVsiRNA-228199 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 AGGGCUUUAUGGGAAGAUUUGU PVsiRNA-228200 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 AGAGACUUAAGUAAAACCACU PVsiRNA-228201 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 ACCUAAGAAUCUCUAAACACGU PVsiRNA-228202 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CGAUUCCAUUUAUCUGUAUGAU PVsiRNA-228203 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UCAGAGAUAGAGGAAUUGUAGU PVsiRNA-228204 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 ACGAACAGGACCUAGCUGAGU PVsiRNA-228205 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 AUCUCCCAGCUGUAGAGCGAGG PVsiRNA-228206 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CGUGAUGAUGGUGAACUCAUGG PVsiRNA-228207 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CUGAGAAGAUCGUCAUUCUGAG PVsiRNA-228208 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CAGAGAUAGAGGAAUUGUAGU PVsiRNA-228209 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CAGAGAUAGAGGAAUUGUAGU PVsiRNA-228210 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CAGAGAUAGAGGAAUUGUAGU PVsiRNA-228211 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CAGAGAUAGAGGAAUUGUAGU PVsiRNA-228212 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 AUCAAUCAGAAGUGUGGAACGU PVsiRNA-228213 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 AUCAAUCAGAAGUGUGGAACGU PVsiRNA-228214 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UCUUCUGUAGUCGGAUGAAGGU PVsiRNA-228215 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UGGACAGAUCGUGAUAUGGAGU PVsiRNA-228216 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 ACCCACACUGUAAACUCAAUU PVsiRNA-228217 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UUAACGAUUUCGCGUACGUGU PVsiRNA-228218 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 ACUGAUCACGGAUAUUGGUAUC PVsiRNA-228219 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 AUUAACGAUUUCGCGUACGUGU PVsiRNA-228220 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CUUUUCAAACUUCUGUGGUACU PVsiRNA-228221 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CUUUUCAAACUUCUGUGGUACU PVsiRNA-228222 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 AGACCUCGUCGAGAAGGACACU PVsiRNA-228223 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UGAGGCUCAGAAUGACGAUCUU PVsiRNA-228224 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UCAACUGUGCUCGUUGGUAGUG PVsiRNA-228225 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UCGUUCUCUGCUCUAUCAGCUU PVsiRNA-228226 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UCGUUCUCUGCUCUAUCAGCUU PVsiRNA-228227 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UCGUUCUCUGCUCUAUCAGCUU PVsiRNA-228228 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UGAAACGGCGUAGUUGUACUUC PVsiRNA-228229 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 AACCGGCUUCAGUUUUCUGAGA PVsiRNA-228230 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CGAUUUCUGUCAAUCUGGACU PVsiRNA-228231 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CGAUUUCUGUCAAUCUGGACU PVsiRNA-228232 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UUCAGACGUUGUAGUUCCAACU PVsiRNA-228233 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UCCUUGUUGGAAAUACCUGACU PVsiRNA-228234 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 GAUACUGAUCACGGAUAUUGGU PVsiRNA-228235 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UUACUGUUGCAGAAAACUCUUU PVsiRNA-228236 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CGCGUAGAAGCUCGCCAAGAUU PVsiRNA-228237 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UCCAGUACGAACAGGACCUAGC PVsiRNA-228238 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 AAACAUGAACUGGACCAACGUG PVsiRNA-228239 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CAAAGACAAGACUCUAAAACU PVsiRNA-228240 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UUGAUGAAAAACGCUGGAGUC PVsiRNA-228241 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 AACCUGCUAGGAAUUUGUAAUC PVsiRNA-228242 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 AUGAAACGGCGUAGUUGUACUU PVsiRNA-228243 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UAAGAAUCUCUAAACACGUACG PVsiRNA-228244 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CGGGACUCGAAUGUUUCUUCC PVsiRNA-228245 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UACUGUUGCAGAAAACUCUUU PVsiRNA-228246 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CAUGAUUGCCUAUUCUGAUGAU PVsiRNA-228247 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CAUGAUUGCCUAUUCUGAUGAU PVsiRNA-228248 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CAUGAUUGCCUAUUCUGAUGAU PVsiRNA-228249 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CUGGCUGAUUUCGCUGAAUGCG PVsiRNA-228250 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CUGGCUGAUUUCGCUGAAUGCG PVsiRNA-228251 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 ACAACCGGACAGGAAGAACUGU PVsiRNA-228252 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 GACACAGAUCCUUGGGCUGAGG PVsiRNA-228253 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UACUCAACUGUGCUCGUUGGU PVsiRNA-228254 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 GUUGAUGAAAAACGCUGGAGUC PVsiRNA-228255 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UUCUUUGGAUGAGAAAGACGG PVsiRNA-228256 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UCGAUUUCAAAUCUAAGACUGG PVsiRNA-228257 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UCCACGGAUGAGCAAGUGCUGG PVsiRNA-228258 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UCAAUCAGAAGUGUGGAACGUU PVsiRNA-228259 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 GAUAGUUUAUACUGGCGUCUGU PVsiRNA-228260 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CCUAAGAAUCUCUAAACACGU PVsiRNA-228261 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CACAGAUCCUUGGGCUGAGGU PVsiRNA-228262 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 AUUGAGAAUGAAAACAUGAACU PVsiRNA-228263 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UAAAAGACUAGGAUUCAAGGU PVsiRNA-228264 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UAAAAGACUAGGAUUCAAGGU PVsiRNA-228265 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UAAAAGACUAGGAUUCAAGGU PVsiRNA-228266 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UGAUGGUGAACUCAUGGAAAUG PVsiRNA-228267 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CAAUGAAUUGCAUCAACUUAGG PVsiRNA-228268 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CAAUGAAUUGCAUCAACUUAGG PVsiRNA-228269 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UACUUGUUCCUGAACCAGAGCU PVsiRNA-228270 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 GACAGAUCGUGAUAUGGAGUU PVsiRNA-228271 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CUUCAGACGUUGUAGUUCCAAC PVsiRNA-228272 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 GAUGGAUAGUUUAUACUGGCGU PVsiRNA-228273 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UCCCGUUGAUGAAAGACGCUGU PVsiRNA-228274 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UGUGCUCGUUGGUAGUGAUACG PVsiRNA-228275 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UGGCUGAUUUCGCUGAAUGCG PVsiRNA-228276 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UGGCUGAUUUCGCUGAAUGCG PVsiRNA-228277 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UGGCUGAUUUCGCUGAAUGCG PVsiRNA-228278 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UGGCUGAUUUCGCUGAAUGCG PVsiRNA-228279 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UGACGUUAUUACUUGAAUACC PVsiRNA-228280 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CGGACGAUUCCAUUUAUCUGU PVsiRNA-228281 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 GAGAAGGACACUCGAAGGCAGU PVsiRNA-228282 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 AUUUCGCGUACGUGUUUAGAGA PVsiRNA-228283 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UGUAACCGGCUUCAGUUUUCUG PVsiRNA-228284 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 AAACAGUCGAAGUACAACUACG PVsiRNA-228285 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 ACCAGUCAAAGACAAGACUCU PVsiRNA-228286 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CUAUCCAUCUGUACUCUUUAGU PVsiRNA-228287 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 ACAGAUCGUGAUAUGGAGUUG PVsiRNA-228288 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 GAUAGAGGAAUUGUAGUAGACC PVsiRNA-228289 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UGAUGAAAGACGCUGUAAACGU PVsiRNA-228290 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 AGGACUGUUAGGCUGCAAGGC PVsiRNA-228291 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 AGGACUGUUAGGCUGCAAGGC PVsiRNA-228292 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 AGGACUGUUAGGCUGCAAGGC PVsiRNA-228293 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 AGGACUGUUAGGCUGCAAGGC PVsiRNA-228294 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 AGGACUGUUAGGCUGCAAGGC PVsiRNA-228295 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 AUGAACUGGACCAACGUGGACG PVsiRNA-228296 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UCAGGGACAGGUUCUAGAGAUG PVsiRNA-228297 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UUGACGUUAUUACUUGAAUACC PVsiRNA-228298 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UCUGUAGAACUCUGAUCAAAGC PVsiRNA-228299 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UCUGAGAAGAUCGUCAUUCUG PVsiRNA-228300 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UAACUUCAGACGUUGUAGUUCC PVsiRNA-228301 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UUGUUUGGGCUUUGAUCAGAGU PVsiRNA-228302 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UUGUUUGGGCUUUGAUCAGAGU PVsiRNA-228303 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UUGUUUGGGCUUUGAUCAGAGU PVsiRNA-228304 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UUGUUUGGGCUUUGAUCAGAGU PVsiRNA-228305 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 ACAUGAUCGUCCGCAAUAGACU PVsiRNA-228306 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 ACAUGAUCGUCCGCAAUAGACU PVsiRNA-228307 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UUAAGUCUCUUACUGUUGCAGA PVsiRNA-228308 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UUAAGUCUCUUACUGUUGCAGA PVsiRNA-228309 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UUAAGUCUCUUACUGUUGCAGA PVsiRNA-228310 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UUAAGUCUCUUACUGUUGCAGA PVsiRNA-228311 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UGAACUGGACCAACGUGGACG PVsiRNA-228312 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 AUACUUGUUCCUGAACCAGAGC PVsiRNA-228313 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UCUUUGGAUGAGAAAGACGGAU PVsiRNA-228314 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UCUUUGGAUGAGAAAGACGGAU PVsiRNA-228315 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UCUUUGGAUGAGAAAGACGGAU PVsiRNA-228316 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CUUUGGAAUAGAGCUUUUCU PVsiRNA-228317 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CUUUGGAAUAGAGCUUUUCU PVsiRNA-228318 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CUUUGGAAUAGAGCUUUUCU PVsiRNA-228319 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CUUUGGAAUAGAGCUUUUCU PVsiRNA-228320 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CUUUGGAAUAGAGCUUUUCU PVsiRNA-228321 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CUUUGGAAUAGAGCUUUUCU PVsiRNA-228322 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CUUUGGAAUAGAGCUUUUCU PVsiRNA-228323 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CUUUGGAAUAGAGCUUUUCU PVsiRNA-228324 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CUUUGGAAUAGAGCUUUUCU PVsiRNA-228325 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CUUUGGAAUAGAGCUUUUCU PVsiRNA-228326 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 CUUUGGAAUAGAGCUUUUCU PVsiRNA-228327 Tobacco Nicotiana benthamiana BrYV Brassica yellows virus 28345652 UUCAAACUUCUGUGGUACUCAGC PVsiRNA-228328 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 Leaves and Stems UUUGGUAGGGGCUGUGCUGCC PVsiRNA-228329 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AGCCACCGGUAGAACGACGUGU PVsiRNA-228330 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AUGUCGAACAGGUAUGCCAUG PVsiRNA-228331 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CUGGAGAAAAUAGAGUUCUGC PVsiRNA-228332 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 ACUGUGUCGCUAGAAUCAAGC PVsiRNA-228333 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AAGACUGAAACUCAAGCUGAGU PVsiRNA-228334 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AAGACUGAAACUCAAGCUGAGU PVsiRNA-228335 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AAGACUGAAACUCAAGCUGAGU PVsiRNA-228336 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UUUCCGUAGAGAAAGUGGUAGU PVsiRNA-228337 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CUGUCGUCGUGGGACUAGACG PVsiRNA-228338 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UCGGCUGGGGGAAGACACUAG PVsiRNA-228339 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 ACAAUGCUAGGACAGAACCCC PVsiRNA-228340 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UAGGACCGGUUGUGCUUCUUCC PVsiRNA-228341 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UGACAAUAAAAGAACUCGAGG PVsiRNA-228342 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UUUGGCUCUGAGCUCCAUGGU PVsiRNA-228343 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UUUGGCUCUGAGCUCCAUGGU PVsiRNA-228344 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UUUGGCUCUGAGCUCCAUGGU PVsiRNA-228345 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UUUGGCUCUGAGCUCCAUGGU PVsiRNA-228346 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UGGAUGUCUCGCCCAAAAGAUC PVsiRNA-228347 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CUGUCGUCGUGGGACUAGACGA PVsiRNA-228348 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CUCCUGCGGGAUAACUGUGUC PVsiRNA-228349 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UGGAGAAGUUCAACAAUGCUG PVsiRNA-228350 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UGGAGAAGUUCAACAAUGCUG PVsiRNA-228351 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UAUGAUCUUUUGGGCGAGACAU PVsiRNA-228352 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AAGGGAGCGAUGUCGAACAGG PVsiRNA-228353 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AAGGGAGCGAUGUCGAACAGG PVsiRNA-228354 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AGCCCUCAGGAUAGUGAGCUCU PVsiRNA-228355 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UUGUCCGUGUAGAACACCCUU PVsiRNA-228356 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AAGGUCAAAGGUAGACGCAUG PVsiRNA-228357 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CAUACUGAUCUCUAUAAAU PVsiRNA-228358 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CAUACUGAUCUCUAUAAAU PVsiRNA-228359 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CAUACUGAUCUCUAUAAAU PVsiRNA-228360 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CAUACUGAUCUCUAUAAAU PVsiRNA-228361 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CAUACUGAUCUCUAUAAAU PVsiRNA-228362 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CAUACUGAUCUCUAUAAAU PVsiRNA-228363 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CAUACUGAUCUCUAUAAAU PVsiRNA-228364 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CACCGAGCUGUUCGAAAGCAAU PVsiRNA-228365 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AAGAGUGGGACCAAGUGCCAGU PVsiRNA-228366 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UUGUGGGUCACUGCUUCGAUG PVsiRNA-228367 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CCAAUUUGCAGAACGAUGGU PVsiRNA-228368 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CCAGGACAAUGUUGAAUCGUG PVsiRNA-228369 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AAGACUGAAACUCAAGCUGAA PVsiRNA-228370 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AAGACUGAAACUCAAGCUGAA PVsiRNA-228371 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AAGACUGAAACUCAAGCUGAA PVsiRNA-228372 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AUGUCGAACAGGUAUGCCAUA PVsiRNA-228373 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 ACUGUGUGCUCAUGGUGUUGC PVsiRNA-228374 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AGCAUUGUUGAACUUCUCCAAG PVsiRNA-228375 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AGCAUUGUUGAACUUCUCCAAG PVsiRNA-228376 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AGUGGUCUGGCUGUGUGUGGU PVsiRNA-228377 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CCGAGCUGUUCGAAAGCAACU PVsiRNA-228378 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CUAGCCUGUGGUCGGCGAGC PVsiRNA-228379 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CAGUACGGAGCUGACCCUGCU PVsiRNA-228380 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UGACAUGGACACCUCUUUGGG PVsiRNA-228381 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UCAAAGGUAGACGCAUGAGCGG PVsiRNA-228382 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CAUUGUCCGUGUAGAACACC PVsiRNA-228383 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CAAGUAAUUGUGGGUCACUGU PVsiRNA-228384 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UGGAAUGCCAUCGCCCAGAGUG PVsiRNA-228385 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CGAUGCGUGGACUCCACAUGA PVsiRNA-228386 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UUAGCAACUGCAGGGUACUUGU PVsiRNA-228387 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UGCGUCCUCUUGGAGAUUUUG PVsiRNA-228388 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UGCGUCCUCUUGGAGAUUUUG PVsiRNA-228389 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UGCGUCCUCUUGGAGAUUUUG PVsiRNA-228390 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CAAUUUGCAGAACGAUGGUAC PVsiRNA-228391 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AUGGACACCUCUUUGGGCAAC PVsiRNA-228392 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 ACAUGAGAAACAGGCUGAAUG PVsiRNA-228393 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UGGAGCCGAUGCUGUACAAAGU PVsiRNA-228394 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CAAUUUGCAGAACGAUGGUGG PVsiRNA-228395 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CAGCCGCAUGGAUAACUCCUGG PVsiRNA-228396 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UUACAGUAGGAGGGGACAGUGC PVsiRNA-228397 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CCGUGACUUGAUGAACCCUCU PVsiRNA-228398 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 GGCAACUGUGUGCUCAUGGUGC PVsiRNA-228399 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UCGACGUUGUGCGUCCUCUUGA PVsiRNA-228400 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CUCAAGUAAUUGUGGGUCACUG PVsiRNA-228401 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 GCCCUCAGGAUAGUGAGCUCU PVsiRNA-228402 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AAUUUGGCUCUGAGCUCCAUGG PVsiRNA-228403 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AAUUUGGCUCUGAGCUCCAUGG PVsiRNA-228404 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 GGGCAUCUUUAGGACUCAGU PVsiRNA-228405 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 ACGACAGGAUCUUUGAAACU PVsiRNA-228406 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 GCAUCUUUAGGACUCAGUGGGU PVsiRNA-228407 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 GACAAUGCUAGGACAGAACCU PVsiRNA-228408 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AGCGAUGUCGAACAGGUAUGA PVsiRNA-228409 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AUGCCCGGGUCAAGACGUUUG PVsiRNA-228410 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CUGGGACCCAGUGUAACUCUCU PVsiRNA-228411 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UGAGACGGGGGAGAUCAUUGC PVsiRNA-228412 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UGAGACGGGGGAGAUCAUUGC PVsiRNA-228413 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UCACCUUUUCGCGUCGACUGU PVsiRNA-228414 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 GCGGAUGGGUAAUAUAUGACG PVsiRNA-228415 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 GUUUGGCAGAACUCUAUUUUC PVsiRNA-228416 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UAACGCCUCAACAGACACAUG PVsiRNA-228417 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UCCUGCGGGAUAACUGUGUC PVsiRNA-228418 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UCCUGCGGGAUAACUGUGUC PVsiRNA-228419 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UAGGUCUGGACCUUUUCUCUA PVsiRNA-228420 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 GCCGAUAUACACGUCGUUCU PVsiRNA-228421 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AAGACUGAAACUCAAGCUGAAC PVsiRNA-228422 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AAGACUGAAACUCAAGCUGAAC PVsiRNA-228423 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 GUGGUCUGGCUGUGUGUGGCG PVsiRNA-228424 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UAGGACCGGUUGUGCUUCUUC PVsiRNA-228425 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 GGUUGAACCGCCGGUUGACGU PVsiRNA-228426 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CUGUGUGCUCAUGGUGUUGCUU PVsiRNA-228427 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 GAUAACUCCUGGCUGCAUUGC PVsiRNA-228428 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 GGGGGACUGCUUUCCGUAGAG PVsiRNA-228429 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CAUACUGAUCUCUAUAAAUACCC PVsiRNA-228430 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AAAUGGUUCUGUGGGUGCCUCU PVsiRNA-228431 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AAAUGGUUCUGUGGGUGCCUCU PVsiRNA-228432 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UUGCUGUUGGGAUGCCACCUC PVsiRNA-228433 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AAUACCUGAAGGGAGCGAUGU PVsiRNA-228434 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AUCUUUAGGACUCAGUGGGUU PVsiRNA-228435 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UGAACACUACUACCACUUUCU PVsiRNA-228436 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CAACUGUGUGCUCAUGGUGCU PVsiRNA-228437 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AAUAGAGUUCUGCCAAACGCA PVsiRNA-228438 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AAUAGAGUUCUGCCAAACGCA PVsiRNA-228439 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AAUAGAGUUCUGCCAAACGCA PVsiRNA-228440 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AAUAGAGUUCUGCCAAACGCA PVsiRNA-228441 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CCAGGACAAUGUUGAAUCGUGG PVsiRNA-228442 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CCAAGACUGAAACUCAAGC PVsiRNA-228443 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CCAAGACUGAAACUCAAGC PVsiRNA-228444 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CCAAGACUGAAACUCAAGC PVsiRNA-228445 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CCAAGACUGAAACUCAAGC PVsiRNA-228446 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CCAAGACUGAAACUCAAGC PVsiRNA-228447 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CCAAGACUGAAACUCAAGC PVsiRNA-228448 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CCAAGACUGAAACUCAAGC PVsiRNA-228449 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CCAAGACUGAAACUCAAGC PVsiRNA-228450 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CCAAGACUGAAACUCAAGC PVsiRNA-228451 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UCAUCCGUUAUUAGCUGGGACU PVsiRNA-228452 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UCAUCCGUUAUUAGCUGGGACU PVsiRNA-228453 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UGCAAAUUGGCAGAGCACGUG PVsiRNA-228454 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UUGUCCUGGCUAAAUACAUCA PVsiRNA-228455 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CGAGCUUUUCAACAAUGGUGA PVsiRNA-228456 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CGAGCUUUUCAACAAUGGUGA PVsiRNA-228457 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UCAAGUAAUUGUGGGUCACUGU PVsiRNA-228458 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CAAAGAGACAUCACUGUAGGC PVsiRNA-228459 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CCUCAGGAUAGUGAGCUCC PVsiRNA-228460 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CCUCAGGAUAGUGAGCUCC PVsiRNA-228461 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CAUGGAUAACUCCUGGCUGCA PVsiRNA-228462 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 AUGGAUAGGGUUGUGGAGAGUU PVsiRNA-228463 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 UAAUUGUGGGUCACUGCUUCG PVsiRNA-228464 Tobacco Nicotiana benthamiana PEMV 2 Pea enation mosaic virus 2 28345652 CUGCCAAUUUGCAGAACGAUG