PVsiRNAdb Id Plant Scientific Name Virus Virus Name PMID Tissue Sequence PVsiRNA-249341 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AUACAACAACUAGAACAAUGGC PVsiRNA-249342 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UAGAACUACAGGAACUGACGGA PVsiRNA-249343 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UACAACAACUAGAACAAUGGCA PVsiRNA-249344 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCUGAACCGUGAAUCUGAAGAA PVsiRNA-249345 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves ACAACAACUAGAACAAUGGCAA PVsiRNA-249346 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAAAGAAGGAAUGAGCGU PVsiRNA-249347 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AGAGAAUGGCAGACCAAGAGCG PVsiRNA-249348 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCAGUUGGCAGAAGAAGAAGU PVsiRNA-249349 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AGAAGACUGGAAGUUUUGCAUG PVsiRNA-249350 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCUGAAAGAAGGAAUGAGCGUA PVsiRNA-249351 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AGAAUUGGGAUUUGGUCGUCGU PVsiRNA-249352 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UACAACAACUAGAACAAUGGC PVsiRNA-249353 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AGAUGACUGGCACCCAUGACGA PVsiRNA-249354 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAGUGAAGAAUUUGUAGGUGUG PVsiRNA-249355 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AGAGCGACAAGAAGAAUCGAA PVsiRNA-249356 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AGAAGACUGGAAGUUUUGCAU PVsiRNA-249357 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AGAACUACAGGAACUGACGGAU PVsiRNA-249358 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAGUAAACGUGCAGGCUCUCA PVsiRNA-249359 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGGGAAUUGACGAUGACGACUG PVsiRNA-249360 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AGAACUACAGGAACUGACGGA PVsiRNA-249361 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UAGGAGAAGAGUGGUGUGACAU PVsiRNA-249362 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAAAUUGUGACUUCGGACGGUU PVsiRNA-249363 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AACCAAUCUUCAGACGUGCUUA PVsiRNA-249364 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GAACUACAGGAACUGACGGAU PVsiRNA-249365 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAACCGUGAAUCUGAAGA PVsiRNA-249366 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCGGAAUCUAUAAUAAGACGUC PVsiRNA-249367 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGCAACACUUGUAGAAAAGCAC PVsiRNA-249368 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GCUGAACAAAUAGAACGUGUA PVsiRNA-249369 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGCUGAACAAAUAGAACGUGUA PVsiRNA-249370 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UAGAACUACAGGAACUGACGG PVsiRNA-249371 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUGUGACUUCGGACGGUUCCAG PVsiRNA-249372 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UAGUUGUCAACUGUAAUCACGG PVsiRNA-249373 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAGGACAUCUCAAACAAUCAGA PVsiRNA-249374 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCUGAACCGUGAAUCUGAAGA PVsiRNA-249375 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGGAAAAAGAUGUAGCAAGAG PVsiRNA-249376 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves ACAGGUGACGAAACAACGGAUG PVsiRNA-249377 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCAGUUGGCAGAAGAAGAAGUU PVsiRNA-249378 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUUUGUUGGCAUACUUACUAUU PVsiRNA-249379 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AGUUGUCAACUGUAAUCACGG PVsiRNA-249380 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAGAGAAUGGCAGACCAAGAGC PVsiRNA-249381 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAAGAUGACUGGCACCCAUGAC PVsiRNA-249382 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAACAAAGCGAAAACGUG PVsiRNA-249383 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUAGAACUACAGGAACUGACGG PVsiRNA-249384 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGUGAUAACAGAAUGACGGCC PVsiRNA-249385 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAUGAAUUCUGAGGAGAAACGA PVsiRNA-249386 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAAAUUGAUGAUCGCGUA PVsiRNA-249387 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGUGACUUCGGACGGUUCCAGU PVsiRNA-249388 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGACGAAACAACGGAUGAGUAU PVsiRNA-249389 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGGAAAAAGAUGUAGCAAGAGU PVsiRNA-249390 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGAACAGGGAUGGAUCCAGGAC PVsiRNA-249391 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AUGAACUGAAGAUCGCACAGCA PVsiRNA-249392 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UAAUGAACUGAAGAUCGCACA PVsiRNA-249393 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGAACUGAAGAUCGCACAGCAC PVsiRNA-249394 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GAUAAUGAACUGAAGAUCGCA PVsiRNA-249395 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGAACUGAAGAUCGCACAGCA PVsiRNA-249396 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCGAUAAUGAACUGAAGAUCGC PVsiRNA-249397 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGAGAAUUCUAAUUUCGUUGGU PVsiRNA-249398 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UAAAGAUUGGGACGUAGAUGGC PVsiRNA-249399 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GAUGAAAAGACAGGCAACUCAG PVsiRNA-249400 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves CGGGAAAGGUAAGAAAUAGCAU PVsiRNA-249401 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAAGACAGGCAACUCAGUAGGA PVsiRNA-249402 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves CGAUAAUGAACUGAAGAUCGCA PVsiRNA-249403 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUGGAAGAAGAAACGUUGGCG PVsiRNA-249404 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCAGAAGUAGAGUAACCGUGA PVsiRNA-249405 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves ACUUGAUUGUAUAGCGUUCGGA PVsiRNA-249406 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAGGACUAGAAGCAGAGGUGCC PVsiRNA-249407 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAAGGACUAGAAGCAGAGGUG PVsiRNA-249408 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAAAGACAGGCAACUCAGUAGG PVsiRNA-249409 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCGGUUUCUGAUGAUGGUUUA PVsiRNA-249410 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCCUGAUCAAGCAACUCAGCAA PVsiRNA-249411 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AGCAAUGGAGAACAGAUCGGCA PVsiRNA-249412 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AUCAAUACCAUAAGAUCGUUGA PVsiRNA-249413 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AGGACUAGAAGCAGAGGUGCC PVsiRNA-249414 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAAAGACAGGCAACUCAGUAG PVsiRNA-249415 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AGGGACUACUGAGUCGCGGGUC PVsiRNA-249416 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAAGAUUGGGACGUAGAUGGC PVsiRNA-249417 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves CUUGAUUGUAUAGCGUUCGGA PVsiRNA-249418 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves CGAUAAUGAACUGAAGAUCGC PVsiRNA-249419 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GAUAAUGAACUGAAGAUCGCAC PVsiRNA-249420 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAAGGACUAGAAGCAGAGGUGC PVsiRNA-249421 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AGGAGCAGAACGAUACAUCGAA PVsiRNA-249422 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAGCACUAGAGAACAAUUACUG PVsiRNA-249423 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AUGAACAAUGAAGACUGGACAU PVsiRNA-249424 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAAGACAGGCAACUCAGUAGG PVsiRNA-249425 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAAGAUUGGGACGUAGAUGGCG PVsiRNA-249426 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCGGUCGGACAAUACACAAAU PVsiRNA-249427 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GAAAAGACAGGCAACUCAGUAG PVsiRNA-249428 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCAAUACCAUAAGAUCGUUGAG PVsiRNA-249429 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAUGAACAAUGAAGACUGGACA PVsiRNA-249430 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCUAGAAUUGGAAGACGCGUU PVsiRNA-249431 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUGAUUGUAUAGCGUUCGGAA PVsiRNA-249432 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves ACACAAUGAACAAUGAAGACUG PVsiRNA-249433 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCAAUGUUUGUUGGGCGGCUAC PVsiRNA-249434 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAGGAGCAGAACGAUACAUCGA PVsiRNA-249435 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UAGCAGAGUGAUUGUUGGUCGG PVsiRNA-249436 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGACUGUGAAUUUAGGAGGAGA PVsiRNA-249437 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAGAUUGGGACGUAGAUGGCG PVsiRNA-249438 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AACAAGACAAUGUAGACUGUA PVsiRNA-249439 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGGAUGAUGAAACGAGUAU PVsiRNA-249440 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGACAGAAGACUGAUGACACAU PVsiRNA-249441 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCCGAACGCUAUACAAUCAAGU PVsiRNA-249442 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCCGAACGCUAUACAAUCAAGU PVsiRNA-249443 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCAACGAUCUUAUGGUAUUGAU PVsiRNA-249444 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCAACGAUCUUAUGGUAUUGAU PVsiRNA-249445 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCAACGAUCUUAUGGUAUUGAU PVsiRNA-249446 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCAACGAUCUUAUGGUAUUGAU PVsiRNA-249447 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCAACGAUCUUAUGGUAUUGAU PVsiRNA-249448 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCAACGAUCUUAUGGUAUUGAU PVsiRNA-249449 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves CUCAACGAUCUUAUGGUAUUGA PVsiRNA-249450 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves CUCAACGAUCUUAUGGUAUUGA PVsiRNA-249451 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves CUCAACGAUCUUAUGGUAUUGA PVsiRNA-249452 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves CUCAACGAUCUUAUGGUAUUGA PVsiRNA-249453 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCGGAAUCUAUAAUAAGACGUC PVsiRNA-249454 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCGGAAUCUAUAAUAAGACGUC PVsiRNA-249455 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCGGAAUCUAUAAUAAGACGUC PVsiRNA-249456 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGCUGUGCGAUCUUCAGUUCAU PVsiRNA-249457 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGCUGUGCGAUCUUCAGUUCAU PVsiRNA-249458 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGCUGUGCGAUCUUCAGUUCAU PVsiRNA-249459 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGCUGUGCGAUCUUCAGUUCAU PVsiRNA-249460 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGCUGUGCGAUCUUCAGUUCAU PVsiRNA-249461 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGCUGUGCGAUCUUCAGUUCAU PVsiRNA-249462 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGCUGUGCGAUCUUCAGUUCAU PVsiRNA-249463 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGUGCGAUCUUCAGUUCAUUA PVsiRNA-249464 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGUGCGAUCUUCAGUUCAUUA PVsiRNA-249465 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGUGCGAUCUUCAGUUCAUUA PVsiRNA-249466 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GUGCUGUGCGAUCUUCAGUUCA PVsiRNA-249467 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GUGCUGUGCGAUCUUCAGUUCA PVsiRNA-249468 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GUGCUGUGCGAUCUUCAGUUCA PVsiRNA-249469 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GUGCUGUGCGAUCUUCAGUUCA PVsiRNA-249470 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGCGAUCUUCAGUUCAUUAUC PVsiRNA-249471 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGCGAUCUUCAGUUCAUUAUCG PVsiRNA-249472 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGCGAUCUUCAGUUCAUUAUCG PVsiRNA-249473 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGCGAUCUUCAGUUCAUUAUCG PVsiRNA-249474 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGCGAUCUUCAGUUCAUUAUCG PVsiRNA-249475 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGCGAUCUUCAGUUCAUUAUCG PVsiRNA-249476 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves CGCCAACGUUUCUUCUUCCAA PVsiRNA-249477 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GGCACCUCUGCUUCUAGUCCUU PVsiRNA-249478 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GGCACCUCUGCUUCUAGUCCUU PVsiRNA-249479 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GGCACCUCUGCUUCUAGUCCUU PVsiRNA-249480 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GGCACCUCUGCUUCUAGUCCUU PVsiRNA-249481 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves CACCUCUGCUUCUAGUCCUUU PVsiRNA-249482 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GCGAUCUUCAGUUCAUUAUCG PVsiRNA-249483 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GCGAUCUUCAGUUCAUUAUCG PVsiRNA-249484 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GCGAUCUUCAGUUCAUUAUCG PVsiRNA-249485 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GCGAUCUUCAGUUCAUUAUCG PVsiRNA-249486 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GUGCGAUCUUCAGUUCAUUAUC PVsiRNA-249487 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GUGCGAUCUUCAGUUCAUUAUC PVsiRNA-249488 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GUGCGAUCUUCAGUUCAUUAUC PVsiRNA-249489 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GCACCUCUGCUUCUAGUCCUUU PVsiRNA-249490 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GCACCUCUGCUUCUAGUCCUUU PVsiRNA-249491 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GCACCUCUGCUUCUAGUCCUUU PVsiRNA-249492 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GCACCUCUGCUUCUAGUCCUUU PVsiRNA-249493 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GCACCUCUGCUUCUAGUCCUUU PVsiRNA-249494 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GCACCUCUGCUUCUAGUCCUUU PVsiRNA-249495 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GCACCUCUGCUUCUAGUCCUUU PVsiRNA-249496 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GCACCUCUGCUUCUAGUCCUUU PVsiRNA-249497 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves CCGACCAACAAUCACUCUGCUA PVsiRNA-249498 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves CCGACCAACAAUCACUCUGCUA PVsiRNA-249499 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves CCGACCAACAAUCACUCUGCUA PVsiRNA-249500 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAGUGAAGAAUUUGUAGGUGUG PVsiRNA-249501 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAGUGAAGAAUUUGUAGGUGUG PVsiRNA-249502 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGCUGAACAAAUAGAACGUGUA PVsiRNA-249503 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AACGCGUCUUCCAAUUCUAGA PVsiRNA-249504 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AUACUCGUUUCAUCAUCCAGAA PVsiRNA-249505 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AUACUCGUUUCAUCAUCCAGAA PVsiRNA-249506 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AUACUCGUUUCAUCAUCCAGAA PVsiRNA-249507 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AUACUCGUUUCAUCAUCCAGAA PVsiRNA-249508 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AUACUCGUUUCAUCAUCCAGAA PVsiRNA-249509 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UAGAACUACAGGAACUGACGGA PVsiRNA-249510 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AGAAGACUGGAAGUUUUGCAUG PVsiRNA-249511 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AGAAGACUGGAAGUUUUGCAUG PVsiRNA-249512 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AGAAGACUGGAAGUUUUGCAUG PVsiRNA-249513 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AGAAGACUGGAAGUUUUGCAUG PVsiRNA-249514 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AGAAGACUGGAAGUUUUGCAUG PVsiRNA-249515 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AGAAGACUGGAAGUUUUGCAUG PVsiRNA-249516 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AGAAGACUGGAAGUUUUGCAUG PVsiRNA-249517 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GAACUACAGGAACUGACGGAU PVsiRNA-249518 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GAACUACAGGAACUGACGGAU PVsiRNA-249519 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAGGACAUCUCAAACAAUCAGA PVsiRNA-249520 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAGGACAUCUCAAACAAUCAGA PVsiRNA-249521 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUAGAACUACAGGAACUGACGG PVsiRNA-249522 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUAGAACUACAGGAACUGACGG PVsiRNA-249523 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUAGAACUACAGGAACUGACGG PVsiRNA-249524 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGUGAUAACAGAAUGACGGCC PVsiRNA-249525 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAUGAAUUCUGAGGAGAAACGA PVsiRNA-249526 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAUGAAUUCUGAGGAGAAACGA PVsiRNA-249527 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AUGCUAUUUCUUACCUUUCCCG PVsiRNA-249528 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AUGCUAUUUCUUACCUUUCCCG PVsiRNA-249529 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCUCCUCCUAAAUUCACAGUCA PVsiRNA-249530 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAGUAAACGUGCAGGCUCUCA PVsiRNA-249531 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves CAGUAAUUGUUCUCUAGUGCUU PVsiRNA-249532 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves CAGUAAUUGUUCUCUAGUGCUU PVsiRNA-249533 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves CAGUAAUUGUUCUCUAGUGCUU PVsiRNA-249534 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AUGUGUCAUCAGUCUUCUGUCA PVsiRNA-249535 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AUACAACAACUAGAACAAUGGC PVsiRNA-249536 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AUACAACAACUAGAACAAUGGC PVsiRNA-249537 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AUACAACAACUAGAACAAUGGC PVsiRNA-249538 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AUACAACAACUAGAACAAUGGC PVsiRNA-249539 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AUACAACAACUAGAACAAUGGC PVsiRNA-249540 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AUACAACAACUAGAACAAUGGC PVsiRNA-249541 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AUACAACAACUAGAACAAUGGC PVsiRNA-249542 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AUACAACAACUAGAACAAUGGC PVsiRNA-249543 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UACAACAACUAGAACAAUGGCA PVsiRNA-249544 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UACAACAACUAGAACAAUGGCA PVsiRNA-249545 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UACAACAACUAGAACAAUGGCA PVsiRNA-249546 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UACAACAACUAGAACAAUGGCA PVsiRNA-249547 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UACAACAACUAGAACAAUGGCA PVsiRNA-249548 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UACAACAACUAGAACAAUGGCA PVsiRNA-249549 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UACAACAACUAGAACAAUGGCA PVsiRNA-249550 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves ACAACAACUAGAACAAUGGCAA PVsiRNA-249551 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves ACAACAACUAGAACAAUGGCAA PVsiRNA-249552 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves ACAACAACUAGAACAAUGGCAA PVsiRNA-249553 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves ACAACAACUAGAACAAUGGCAA PVsiRNA-249554 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves ACAACAACUAGAACAAUGGCAA PVsiRNA-249555 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves ACAACAACUAGAACAAUGGCAA PVsiRNA-249556 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves ACAACAACUAGAACAAUGGCAA PVsiRNA-249557 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCAGUUGGCAGAAGAAGAAGU PVsiRNA-249558 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCAGUUGGCAGAAGAAGAAGU PVsiRNA-249559 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCAGUUGGCAGAAGAAGAAGU PVsiRNA-249560 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCAGUUGGCAGAAGAAGAAGU PVsiRNA-249561 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AGAAUUGGGAUUUGGUCGUCGU PVsiRNA-249562 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AGAAUUGGGAUUUGGUCGUCGU PVsiRNA-249563 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AGAAUUGGGAUUUGGUCGUCGU PVsiRNA-249564 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AGAAUUGGGAUUUGGUCGUCGU PVsiRNA-249565 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AGAAUUGGGAUUUGGUCGUCGU PVsiRNA-249566 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AGAAUUGGGAUUUGGUCGUCGU PVsiRNA-249567 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UACAACAACUAGAACAAUGGC PVsiRNA-249568 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UACAACAACUAGAACAAUGGC PVsiRNA-249569 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UACAACAACUAGAACAAUGGC PVsiRNA-249570 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAAAUUGUGACUUCGGACGGUU PVsiRNA-249571 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAAAUUGUGACUUCGGACGGUU PVsiRNA-249572 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAAAUUGUGACUUCGGACGGUU PVsiRNA-249573 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AACCAAUCUUCAGACGUGCUUA PVsiRNA-249574 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AACCAAUCUUCAGACGUGCUUA PVsiRNA-249575 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AACCAAUCUUCAGACGUGCUUA PVsiRNA-249576 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AACCAAUCUUCAGACGUGCUUA PVsiRNA-249577 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGGAAAAAGAUGUAGCAAGAG PVsiRNA-249578 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGGAAAAAGAUGUAGCAAGAG PVsiRNA-249579 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGGAAAAAGAUGUAGCAAGAG PVsiRNA-249580 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGGAAAAAGAUGUAGCAAGAG PVsiRNA-249581 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCAGUUGGCAGAAGAAGAAGUU PVsiRNA-249582 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCAGUUGGCAGAAGAAGAAGUU PVsiRNA-249583 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGUGACUUCGGACGGUUCCAGU PVsiRNA-249584 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGGAAAAAGAUGUAGCAAGAGU PVsiRNA-249585 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGGAAAAAGAUGUAGCAAGAGU PVsiRNA-249586 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGGAAAAAGAUGUAGCAAGAGU PVsiRNA-249587 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGGAAAAAGAUGUAGCAAGAGU PVsiRNA-249588 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGGAAAAAGAUGUAGCAAGAGU PVsiRNA-249589 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGGAAAAAGAUGUAGCAAGAGU PVsiRNA-249590 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGGAAAAAGAUGUAGCAAGAGU PVsiRNA-249591 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGAACAGGGAUGGAUCCAGGAC PVsiRNA-249592 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGAACAGGGAUGGAUCCAGGAC PVsiRNA-249593 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGAACAGGGAUGGAUCCAGGAC PVsiRNA-249594 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGAACAGGGAUGGAUCCAGGAC PVsiRNA-249595 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGAACAGGGAUGGAUCCAGGAC PVsiRNA-249596 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGAACAGGGAUGGAUCCAGGAC PVsiRNA-249597 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGAACAGGGAUGGAUCCAGGAC PVsiRNA-249598 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGAACAGGGAUGGAUCCAGGAC PVsiRNA-249599 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGAACAGGGAUGGAUCCAGGAC PVsiRNA-249600 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGAACAGGGAUGGAUCCAGGAC PVsiRNA-249601 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGAACAGGGAUGGAUCCAGGAC PVsiRNA-249602 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGAACAGGGAUGGAUCCAGGAC PVsiRNA-249603 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGAACAGGGAUGGAUCCAGGAC PVsiRNA-249604 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGAACAGGGAUGGAUCCAGGAC PVsiRNA-249605 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGAACAGGGAUGGAUCCAGGAC PVsiRNA-249606 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGAACAGGGAUGGAUCCAGGAC PVsiRNA-249607 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGAACAGGGAUGGAUCCAGGAC PVsiRNA-249608 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGAACAGGGAUGGAUCCAGGAC PVsiRNA-249609 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GACCCGCGACUCAGUAGUCCCU PVsiRNA-249610 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GACCCGCGACUCAGUAGUCCCU PVsiRNA-249611 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GACCCGCGACUCAGUAGUCCCU PVsiRNA-249612 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAAAGAAGGAAUGAGCGU PVsiRNA-249613 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAAAGAAGGAAUGAGCGU PVsiRNA-249614 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAAAGAAGGAAUGAGCGU PVsiRNA-249615 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAAAGAAGGAAUGAGCGU PVsiRNA-249616 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAAAGAAGGAAUGAGCGU PVsiRNA-249617 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAAAGAAGGAAUGAGCGU PVsiRNA-249618 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAAAGAAGGAAUGAGCGU PVsiRNA-249619 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAAAGAAGGAAUGAGCGU PVsiRNA-249620 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAAAGAAGGAAUGAGCGU PVsiRNA-249621 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAAAGAAGGAAUGAGCGU PVsiRNA-249622 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAAAGAAGGAAUGAGCGU PVsiRNA-249623 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAAAGAAGGAAUGAGCGU PVsiRNA-249624 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAAAGAAGGAAUGAGCGU PVsiRNA-249625 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAAAGAAGGAAUGAGCGU PVsiRNA-249626 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAAAGAAGGAAUGAGCGU PVsiRNA-249627 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAAAGAAGGAAUGAGCGU PVsiRNA-249628 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAAAGAAGGAAUGAGCGU PVsiRNA-249629 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAAAGAAGGAAUGAGCGU PVsiRNA-249630 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAAAGAAGGAAUGAGCGU PVsiRNA-249631 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAAAGAAGGAAUGAGCGU PVsiRNA-249632 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAAAGAAGGAAUGAGCGU PVsiRNA-249633 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAAAGAAGGAAUGAGCGU PVsiRNA-249634 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAAAGAAGGAAUGAGCGU PVsiRNA-249635 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAAAGAAGGAAUGAGCGU PVsiRNA-249636 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAAAGAAGGAAUGAGCGU PVsiRNA-249637 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCUGAAAGAAGGAAUGAGCGUA PVsiRNA-249638 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCUGAAAGAAGGAAUGAGCGUA PVsiRNA-249639 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCUGAAAGAAGGAAUGAGCGUA PVsiRNA-249640 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCUGAAAGAAGGAAUGAGCGUA PVsiRNA-249641 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCUGAAAGAAGGAAUGAGCGUA PVsiRNA-249642 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCUGAAAGAAGGAAUGAGCGUA PVsiRNA-249643 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGCAACACUUGUAGAAAAGCAC PVsiRNA-249644 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGCAACACUUGUAGAAAAGCAC PVsiRNA-249645 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGCAACACUUGUAGAAAAGCAC PVsiRNA-249646 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGCAACACUUGUAGAAAAGCAC PVsiRNA-249647 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGCAACACUUGUAGAAAAGCAC PVsiRNA-249648 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UAGUUGUCAACUGUAAUCACGG PVsiRNA-249649 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UAGUUGUCAACUGUAAUCACGG PVsiRNA-249650 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UAGUUGUCAACUGUAAUCACGG PVsiRNA-249651 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UAGUUGUCAACUGUAAUCACGG PVsiRNA-249652 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UAGUUGUCAACUGUAAUCACGG PVsiRNA-249653 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves ACAGGUGACGAAACAACGGAUG PVsiRNA-249654 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves ACAGGUGACGAAACAACGGAUG PVsiRNA-249655 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves ACAGGUGACGAAACAACGGAUG PVsiRNA-249656 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUUUGUUGGCAUACUUACUAUU PVsiRNA-249657 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUUUGUUGGCAUACUUACUAUU PVsiRNA-249658 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GCCAUCUACGUCCCAAUCUUUA PVsiRNA-249659 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GCCAUCUACGUCCCAAUCUUUA PVsiRNA-249660 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GCCAUCUACGUCCCAAUCUUUA PVsiRNA-249661 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GCCAUCUACGUCCCAAUCUUUA PVsiRNA-249662 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGCCGAUCUGUUCUCCAUUGCU PVsiRNA-249663 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGCCGAUCUGUUCUCCAUUGCU PVsiRNA-249664 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AUGUCCAGUCUUCAUUGUUCAU PVsiRNA-249665 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AUGUCCAGUCUUCAUUGUUCAU PVsiRNA-249666 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AUGUCCAGUCUUCAUUGUUCAU PVsiRNA-249667 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AUGUCCAGUCUUCAUUGUUCAU PVsiRNA-249668 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AUGUCCAGUCUUCAUUGUUCAU PVsiRNA-249669 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves CGCCAUCUACGUCCCAAUCUUU PVsiRNA-249670 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves CGCCAUCUACGUCCCAAUCUUU PVsiRNA-249671 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGUCCAGUCUUCAUUGUUCAUU PVsiRNA-249672 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGUCCAGUCUUCAUUGUUCAUU PVsiRNA-249673 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGUCCAGUCUUCAUUGUUCAUU PVsiRNA-249674 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGUCCAGUCUUCAUUGUUCAUU PVsiRNA-249675 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGUCCAGUCUUCAUUGUUCAUU PVsiRNA-249676 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGUCCAGUCUUCAUUGUUCAUU PVsiRNA-249677 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UGUCCAGUCUUCAUUGUUCAUU PVsiRNA-249678 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves CAGUCUUCAUUGUUCAUUGUGU PVsiRNA-249679 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAACAAAGCGAAAACGUG PVsiRNA-249680 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAACAAAGCGAAAACGUG PVsiRNA-249681 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAACAAAGCGAAAACGUG PVsiRNA-249682 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves CUGAGUUGCCUGUCUUUUCAUC PVsiRNA-249683 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves CUGAGUUGCCUGUCUUUUCAUC PVsiRNA-249684 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCACGGUUACUCUACUUCUGAA PVsiRNA-249685 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCACGGUUACUCUACUUCUGAA PVsiRNA-249686 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCACGGUUACUCUACUUCUGAA PVsiRNA-249687 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCACGGUUACUCUACUUCUGAA PVsiRNA-249688 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUGCUGAGUUGCUUGAUCAGGA PVsiRNA-249689 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUGCUGAGUUGCUUGAUCAGGA PVsiRNA-249690 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCGAUGUAUCGUUCUGCUCCU PVsiRNA-249691 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCGAUGUAUCGUUCUGCUCCU PVsiRNA-249692 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCGAUGUAUCGUUCUGCUCCU PVsiRNA-249693 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCGAUGUAUCGUUCUGCUCCU PVsiRNA-249694 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCGAUGUAUCGUUCUGCUCCU PVsiRNA-249695 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCGAUGUAUCGUUCUGCUCCU PVsiRNA-249696 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves CUACUGAGUUGCCUGUCUUUUC PVsiRNA-249697 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves GUAGCCGCCCAACAAACAUUGA PVsiRNA-249698 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UAGGAGAAGAGUGGUGUGACAU PVsiRNA-249699 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UAGGAGAAGAGUGGUGUGACAU PVsiRNA-249700 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UAGGAGAAGAGUGGUGUGACAU PVsiRNA-249701 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UAGGAGAAGAGUGGUGUGACAU PVsiRNA-249702 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UAGGAGAAGAGUGGUGUGACAU PVsiRNA-249703 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UAGGAGAAGAGUGGUGUGACAU PVsiRNA-249704 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UAGGAGAAGAGUGGUGUGACAU PVsiRNA-249705 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UAGGAGAAGAGUGGUGUGACAU PVsiRNA-249706 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UAGGAGAAGAGUGGUGUGACAU PVsiRNA-249707 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UAGGAGAAGAGUGGUGUGACAU PVsiRNA-249708 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UAGGAGAAGAGUGGUGUGACAU PVsiRNA-249709 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UAGGAGAAGAGUGGUGUGACAU PVsiRNA-249710 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UAGGAGAAGAGUGGUGUGACAU PVsiRNA-249711 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UAGGAGAAGAGUGGUGUGACAU PVsiRNA-249712 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UAGGAGAAGAGUGGUGUGACAU PVsiRNA-249713 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AGAUGACUGGCACCCAUGACGA PVsiRNA-249714 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAAGAUGACUGGCACCCAUGAC PVsiRNA-249715 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAAGAUGACUGGCACCCAUGAC PVsiRNA-249716 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAAGAUGACUGGCACCCAUGAC PVsiRNA-249717 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCUGAACCGUGAAUCUGAAGAA PVsiRNA-249718 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCUGAACCGUGAAUCUGAAGAA PVsiRNA-249719 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCUGAACCGUGAAUCUGAAGAA PVsiRNA-249720 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCUGAACCGUGAAUCUGAAGAA PVsiRNA-249721 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCUGAACCGUGAAUCUGAAGAA PVsiRNA-249722 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCUGAACCGUGAAUCUGAAGAA PVsiRNA-249723 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AGAGAAUGGCAGACCAAGAGCG PVsiRNA-249724 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AGAGAAUGGCAGACCAAGAGCG PVsiRNA-249725 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AGAGAAUGGCAGACCAAGAGCG PVsiRNA-249726 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AGAGAAUGGCAGACCAAGAGCG PVsiRNA-249727 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAACCGUGAAUCUGAAGA PVsiRNA-249728 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAACCGUGAAUCUGAAGA PVsiRNA-249729 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAACCGUGAAUCUGAAGA PVsiRNA-249730 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAACCGUGAAUCUGAAGA PVsiRNA-249731 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAACCGUGAAUCUGAAGA PVsiRNA-249732 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAACCGUGAAUCUGAAGA PVsiRNA-249733 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAACCGUGAAUCUGAAGA PVsiRNA-249734 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAACCGUGAAUCUGAAGA PVsiRNA-249735 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAACCGUGAAUCUGAAGA PVsiRNA-249736 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAACCGUGAAUCUGAAGA PVsiRNA-249737 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAACCGUGAAUCUGAAGA PVsiRNA-249738 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAACCGUGAAUCUGAAGA PVsiRNA-249739 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAACCGUGAAUCUGAAGA PVsiRNA-249740 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAACCGUGAAUCUGAAGA PVsiRNA-249741 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAACCGUGAAUCUGAAGA PVsiRNA-249742 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAACCGUGAAUCUGAAGA PVsiRNA-249743 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCUGAACCGUGAAUCUGAAGA PVsiRNA-249744 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCUGAACCGUGAAUCUGAAGA PVsiRNA-249745 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCUGAACCGUGAAUCUGAAGA PVsiRNA-249746 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCUGAACCGUGAAUCUGAAGA PVsiRNA-249747 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCUGAACCGUGAAUCUGAAGA PVsiRNA-249748 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UCUGAACCGUGAAUCUGAAGA PVsiRNA-249749 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAGAGAAUGGCAGACCAAGAGC PVsiRNA-249750 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAGAGAAUGGCAGACCAAGAGC PVsiRNA-249751 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAGAGAAUGGCAGACCAAGAGC PVsiRNA-249752 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAGAGAAUGGCAGACCAAGAGC PVsiRNA-249753 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAGAGAAUGGCAGACCAAGAGC PVsiRNA-249754 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves AAGAGAAUGGCAGACCAAGAGC PVsiRNA-249755 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAAAUUGAUGAUCGCGUA PVsiRNA-249756 Maize Zea mays RBSDV Rice black streaked dwarf virus 27888127 Leaves UUCUGAAAUUGAUGAUCGCGUA PVsiRNA-249775 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAAGCCUUGUCGAGACUCUGC PVsiRNA-249776 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AACCACAGAUUGCAAGAGACC PVsiRNA-249777 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AACCCUGGGGCAAGUAGAUGCU PVsiRNA-249778 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AACCUGUGUACAUCCUUGAACA PVsiRNA-249779 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAGCCUUGUCGAGACUCUGCU PVsiRNA-249780 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACAGGGAAAAGACUUUGACAGU PVsiRNA-249781 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGAGGGUUUCUGAACUCAACG PVsiRNA-249782 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACUAAAUCUGAAGGAGCACCUG PVsiRNA-249783 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGAAUGACAUCAAGUCUUGGAC PVsiRNA-249784 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGCCAAUGAACUUACGGUUUG PVsiRNA-249785 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGCCUAAAUCGUAUACUAGUA PVsiRNA-249786 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGUUGACUCACGUCUUGCAUCC PVsiRNA-249787 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUACACAAUGGCGGCAAGUAGC PVsiRNA-249788 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUCCGGAAAGCCUUGUCGAGAC PVsiRNA-249789 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUUGGGCAAUUGCAUACUGGCC PVsiRNA-249790 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAAAAGAUCGACAUACACAAUG PVsiRNA-249791 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAACCACAGAUUGCAAGAGACC PVsiRNA-249792 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAACGUCCUGAUCUGUCCGGC PVsiRNA-249793 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACGAGGGUUUCUGAACUCAAC PVsiRNA-249794 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACUAAAUCUGAAGGAGCACC PVsiRNA-249795 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAGGGAAAAGACUUUGACAGU PVsiRNA-249796 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAGUUGACUCACGUCUUGCAUC PVsiRNA-249797 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAUCGCAAUCAGUUGGAAAAC PVsiRNA-249798 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAUGGACAACACGUACUUACG PVsiRNA-249799 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CCAUGGACAACACGUACUUACG PVsiRNA-249800 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CCGGAACAACCAGUCCUUCUG PVsiRNA-249801 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CGAAACAAGUUGACUCGGACU PVsiRNA-249802 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CGACAUGGUAACUGGAUACACU PVsiRNA-249803 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CGAGACUCUGCUUGACACGGA PVsiRNA-249804 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CUACGGAUUUGAAGUCAUAUC PVsiRNA-249805 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CUUGACGAAGACACAGGACACC PVsiRNA-249806 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves GCCGUGCGAUCUGAAGACAACC PVsiRNA-249807 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves GCCUUGUCGAGACUCUGCUUGA PVsiRNA-249808 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves GGCCAAAUCAAAAUCUCGUACU PVsiRNA-249809 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves GUAACUGGAUACACUUAACCCU PVsiRNA-249810 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves GUGUGUAGAUUCGUCCUGGCC PVsiRNA-249811 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves GUGUGUAGAUUCGUCCUGGCCU PVsiRNA-249812 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UAACCACUUCAAUUUCAACUG PVsiRNA-249813 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UAACCCUGGGGCAAGUAGAUGC PVsiRNA-249814 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UAAGAAAGCUGAUCCUGUACC PVsiRNA-249815 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UACAAUAGCUCUGAAGAACAGA PVsiRNA-249816 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UACACAAUGGCGGCAAGUAGC PVsiRNA-249817 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UAUCUGAGACCGGUUGAGCACC PVsiRNA-249818 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UCGAAACAAGUUGACUCGGACU PVsiRNA-249819 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UCGAGACUCUGCUUGACACGGA PVsiRNA-249820 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UGCGAUCUGAAGACAACCAUCG PVsiRNA-249821 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UGCUGACCAGAUUCUCGAGAUU PVsiRNA-249822 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UGUGUGUAGAUUCGUCCUGGCC PVsiRNA-249823 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UUGACGAAGACACAGGACACC PVsiRNA-249824 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UUGGGCAAUUGCAUACUGGCC PVsiRNA-249825 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAACACUUUGGAUUGGCAGGAC PVsiRNA-249826 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAGACAUUCGGGAAUUUCUGCC PVsiRNA-249827 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACACGGAGUACGAGAUUUUGA PVsiRNA-249828 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACACGGAGUACGAGAUUUUGAU PVsiRNA-249829 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACAGAUCAGGACGUUGUCAUC PVsiRNA-249830 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACCAGCCUGUAUACACCUGAAC PVsiRNA-249831 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGAUUUAGGCUCCCAAACACU PVsiRNA-249832 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACUAGUAUACGAUUUAGGCUCC PVsiRNA-249833 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGAACGUGUUUAGUCAGACAGU PVsiRNA-249834 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGACAUUCGGGAAUUUCUGCC PVsiRNA-249835 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGAUGAACAGAAUCGAGGAGAU PVsiRNA-249836 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGCAGAAUUUCGGACAUGGAGC PVsiRNA-249837 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGCCUGUAUACACCUGAACACA PVsiRNA-249838 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGGACCAAACUCACGGAUGAGA PVsiRNA-249839 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUACCGUGACGUUUGUUGAAUC PVsiRNA-249840 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUAGCCACAAUGAAUCGUCCUG PVsiRNA-249841 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUCGGAUUUUAGCUCCCACCU PVsiRNA-249842 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUGAACAGAAUCGAGGAGAUC PVsiRNA-249843 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUGCAGCAAACUGACCAGCCU PVsiRNA-249844 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAACGAUCUGUGAACAUAGCU PVsiRNA-249845 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACAAUGAAUCGUCCUGGGGA PVsiRNA-249846 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACAUCUGUGAUUGUGCUGCC PVsiRNA-249847 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACGGAGUACGAGAUUUUGAU PVsiRNA-249848 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACGGAGUACGAGAUUUUGAUU PVsiRNA-249849 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAGAAUUUCGGACAUGGAGCA PVsiRNA-249850 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CCAUUGUUGAUUAAUCUGGCU PVsiRNA-249851 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CCGCGAUUAUGAAUCUGCCACC PVsiRNA-249852 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CGAACUGCUAGCCGAACAUACC PVsiRNA-249853 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CGAGGACACAUGAAAUAUAUGC PVsiRNA-249854 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CGCGAUUAUGAAUCUGCCACC PVsiRNA-249855 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CGGACAGAUCAGGACGUUGUC PVsiRNA-249856 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CUACUAGUAUACGAUUUAGGCU PVsiRNA-249857 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CUAGUAUACGAUUUAGGCUCC PVsiRNA-249858 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CUGGAAUCUCGAGAAUCUGGUC PVsiRNA-249859 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves GAGGACACAUGAAAUAUAUGCC PVsiRNA-249860 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves GCAGAAUUUCGGACAUGGAGC PVsiRNA-249861 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves GUCCUGUGUCUUCGUCAAGAUG PVsiRNA-249862 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves GUUCCGCGAUUAUGAAUCUGCC PVsiRNA-249863 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UACCGUGACGUUUGUUGAAUC PVsiRNA-249864 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UACUAGUAUACGAUUUAGGCU PVsiRNA-249865 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UAGACAUACUCUUUCAAUGCCU PVsiRNA-249866 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UAGUAUACGAUUUAGGCUCCC PVsiRNA-249867 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UCGCACCGUUCGUAAGUACGUG PVsiRNA-249868 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UGAUCGGAUUUUAGCUCCCACC PVsiRNA-249869 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UGCAACGAUCUGUGAACAUAGC PVsiRNA-249870 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UGCAAGACGUGAGUCAACUGUA PVsiRNA-249871 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UGCAAGCAGAAUUUCGGACAUG PVsiRNA-249872 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UGUCGCACCGUUCGUAAGUACG PVsiRNA-249873 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UGUCUGAUCGAUCGAGUACACC PVsiRNA-249874 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UUCGAGUAGACAUCCACAGAC PVsiRNA-249875 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAAAUGCGGACAGUGAUUAAC PVsiRNA-249876 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAAUGCGGACAGUGAUUAACAC PVsiRNA-249877 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AACACGAUCGGAAAUGAAUAAG PVsiRNA-249878 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AACAGAUAAUAGAGGAAGAACC PVsiRNA-249879 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AACAGAUAAUAGAGGAAGAACC PVsiRNA-249880 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AACAGAUAAUAGAGGAAGAACC PVsiRNA-249881 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AACAGAUAAUAGAGGAAGAACC PVsiRNA-249882 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AACAGAUAAUAGAGGAAGAACC PVsiRNA-249883 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AACAGAUAAUAGAGGAAGAACC PVsiRNA-249884 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AACAGAUAAUAGAGGAAGAACC PVsiRNA-249885 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AACAGAUAAUAGAGGAAGAACC PVsiRNA-249886 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AACCAUUGACACUAAGUACUG PVsiRNA-249887 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AACGGACGAGGAUGAAAUAUU PVsiRNA-249888 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AACGGACGAGGAUGAAAUAUUC PVsiRNA-249889 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAGAGGAUGGCACUGUUAGAAA PVsiRNA-249890 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAGAGGAUGGCACUGUUAGAAA PVsiRNA-249891 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAGAGUUGGAAGGAACAAGCC PVsiRNA-249892 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAGUCGAGAUCGAGUCAGCUC PVsiRNA-249893 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAUGCGGACAGUGAUUAACAC PVsiRNA-249894 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAUUAUUUCGAAGCUGUGGACC PVsiRNA-249895 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAUUAUUUCGAAGCUGUGGACC PVsiRNA-249896 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACAGAUAAUAGAGGAAGAACC PVsiRNA-249897 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACAGAUAAUAGAGGAAGAACC PVsiRNA-249898 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACAGGAACAAGAACACCAUCU PVsiRNA-249899 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACAUACUGGAUUGUCAAGAACC PVsiRNA-249900 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACCCUGACAAGAUCUCUGAAU PVsiRNA-249901 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACCGUGGGACAACUGAUAAAAU PVsiRNA-249902 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGGAAAUGUCGGCGAGACUC PVsiRNA-249903 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGGACGAGGAUGAAAUAUUC PVsiRNA-249904 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGGACGAGGAUGAAAUAUUC PVsiRNA-249905 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGGACGAGGAUGAAAUAUUC PVsiRNA-249906 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGGACGAGGAUGAAAUAUUC PVsiRNA-249907 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGGACGAGGAUGAAAUAUUC PVsiRNA-249908 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGGACGAGGAUGAAAUAUUCC PVsiRNA-249909 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGGACGAGGAUGAAAUAUUCC PVsiRNA-249910 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGGACGAGGAUGAAAUAUUCC PVsiRNA-249911 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGGACGAGGAUGAAAUAUUCC PVsiRNA-249912 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGGACGAGGAUGAAAUAUUCC PVsiRNA-249913 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGGAGAUUUCUGGAAACACU PVsiRNA-249914 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGGUGAAUGCAGAAGAACUAC PVsiRNA-249915 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACUUCUGUGGUCUCACCUAGA PVsiRNA-249916 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGAAAAAGCGUAGAUUUAGGC PVsiRNA-249917 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGAGACAAAGACGUUGACGCU PVsiRNA-249918 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGAGUUGGAAGGAACAAGCCC PVsiRNA-249919 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGCAUGUGAUGGAAAUAGAACA PVsiRNA-249920 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGCGGAUACAUUUAGUAAUGAC PVsiRNA-249921 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGGAUGGCACUGUUAGAAAUC PVsiRNA-249922 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGGAUGGCACUGUUAGAAAUCC PVsiRNA-249923 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUCGGAAAUGAAUAAGGAACU PVsiRNA-249924 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUGGAUACUGUUACAUUAACA PVsiRNA-249925 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUUUCCAGAAGAUCAGAGACU PVsiRNA-249926 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUUUCCAGAAGAUCAGAGACU PVsiRNA-249927 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUUUCCAGAAGAUCAGAGACU PVsiRNA-249928 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUUUCCAGAAGAUCAGAGACU PVsiRNA-249929 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAAUGUCGAAGAAAAUGCGCC PVsiRNA-249930 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAAUGUCGAAGAAAAUGCGCC PVsiRNA-249931 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAAUGUCGAAGAAAAUGCGCC PVsiRNA-249932 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACGGUGAAUGCAGAAGAACU PVsiRNA-249933 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACUAGUCUCCUGGAAACCCU PVsiRNA-249934 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACUAGUCUCCUGGAAACCCU PVsiRNA-249935 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACUAGUCUCCUGGAAACCCU PVsiRNA-249936 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACUAGUCUCCUGGAAACCCU PVsiRNA-249937 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACUGAGAGUUGAUUUGACGCC PVsiRNA-249938 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACUGUUAGAAAUCCUAUUCC PVsiRNA-249939 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAGCCGUCAACAGUUGUAGAC PVsiRNA-249940 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAGCGGAUACAUUUAGUAAUG PVsiRNA-249941 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAUGGCUCACGGAGUGUAUUC PVsiRNA-249942 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CGGUCGAACUUACCUGAGCACC PVsiRNA-249943 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves GGAUGGCACUGUUAGAAAUCC PVsiRNA-249944 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UAACGGACGAGGAUGAAAUAUU PVsiRNA-249945 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UACCGUGGGACAACUGAUAAAA PVsiRNA-249946 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UAUUUCGAAGCUGUGGACCCA PVsiRNA-249947 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UCUUGGACUCACGUGACAUACA PVsiRNA-249948 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UUAUUUCGAAGCUGUGGACCC PVsiRNA-249949 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UUAUUUCGAAGCUGUGGACCCA PVsiRNA-249950 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UUUCCAGAAGAUCAGAGACUC PVsiRNA-249951 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AACGAGUCUCUGAUCUUCUGGA PVsiRNA-249952 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAGCCUGUGGAUUUUCCUGACC PVsiRNA-249953 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAGCCUGUGGAUUUUCCUGACC PVsiRNA-249954 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAGCCUGUGGAUUUUCCUGACC PVsiRNA-249955 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAGCCUGUGGAUUUUCCUGACC PVsiRNA-249956 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAGCCUGUGGAUUUUCCUGACC PVsiRNA-249957 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAGUGAAUCAUGCGUAGAAGUU PVsiRNA-249958 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAUAGGAUUUCUAACAGUGCC PVsiRNA-249959 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAUGAGAUUUGGGUUGUAAUGC PVsiRNA-249960 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACAGAGAGUGCAUGUUGCGAC PVsiRNA-249961 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACCGUGCUGUAGCAUUUCGCA PVsiRNA-249962 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGAAGCAUUUCUUACUGGAUG PVsiRNA-249963 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGAGUCUCUGAUCUUCUGGA PVsiRNA-249964 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGACUUUGUAGUUCUUCUGCAU PVsiRNA-249965 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGACUUUGUAGUUCUUCUGCAU PVsiRNA-249966 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGACUUUGUAGUUCUUCUGCAU PVsiRNA-249967 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGACUUUGUAGUUCUUCUGCAU PVsiRNA-249968 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGACUUUGUAGUUCUUCUGCAU PVsiRNA-249969 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGACUUUGUAGUUCUUCUGCAU PVsiRNA-249970 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGACUUUGUAGUUCUUCUGCAU PVsiRNA-249971 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGAUUGCUGUAUAACUUGGCC PVsiRNA-249972 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGAUUGCUGUAUAACUUGGCCC PVsiRNA-249973 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGCCUGUGGAUUUUCCUGACC PVsiRNA-249974 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGCCUGUGGAUUUUCCUGACCC PVsiRNA-249975 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGUAAAUACGAGGUAGAACCU PVsiRNA-249976 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGUAGAAUUGGUUGUUGAAAUC PVsiRNA-249977 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGUAGAAUUGGUUGUUGAAAUC PVsiRNA-249978 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGUAGAAUUGGUUGUUGAAAUC PVsiRNA-249979 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGUAGAAUUGGUUGUUGAAAUC PVsiRNA-249980 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGUAGAAUUGGUUGUUGAAAUC PVsiRNA-249981 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGUAGAAUUGGUUGUUGAAAUC PVsiRNA-249982 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGUAGAAUUGGUUGUUGAAAUC PVsiRNA-249983 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGUAGAAUUGGUUGUUGAAAUC PVsiRNA-249984 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGUAGAAUUGGUUGUUGAAAUC PVsiRNA-249985 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGUAUUAACUUUGAUGAGCGCC PVsiRNA-249986 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGUGAAUCAUGCGUAGAAGUU PVsiRNA-249987 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGUUCCAGAUCAUCAAUAUUG PVsiRNA-249988 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUAGUAAAUACGAGGUAGAAC PVsiRNA-249989 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUAGUAAAUACGAGGUAGAACC PVsiRNA-249990 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUCCCUGAUCAAUUUCGUGACG PVsiRNA-249991 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUCCCUGAUCAAUUUCGUGACG PVsiRNA-249992 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUGGCACAUUCUGUUCGAUUG PVsiRNA-249993 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUUGCUGUAUAACUUGGCCCC PVsiRNA-249994 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACCAAGAACUUCCUCUGAUC PVsiRNA-249995 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACCAAGAACUUCCUCUGAUC PVsiRNA-249996 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACCAAGAACUUCCUCUGAUCC PVsiRNA-249997 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACCAAGAACUUCCUCUGAUCC PVsiRNA-249998 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACCAAGAACUUCCUCUGAUCC PVsiRNA-249999 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACCAAGAACUUCCUCUGAUCC PVsiRNA-250000 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACCGUGCUGUAGCAUUUCGCA PVsiRNA-250001 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACCGUGCUGUAGCAUUUCGCA PVsiRNA-250002 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAGAUUGCUGUAUAACUUGGC PVsiRNA-250003 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAGUUCCAGAUCAUCAAUAUUG PVsiRNA-250004 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAGUUCCAGAUCAUCAAUAUUG PVsiRNA-250005 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAGUUCCAGAUCAUCAAUAUUG PVsiRNA-250006 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAGUUCCAGAUCAUCAAUAUUG PVsiRNA-250007 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAGUUCCAGAUCAUCAAUAUUG PVsiRNA-250008 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CCAUAGCAACUUGUAGGGCUG PVsiRNA-250009 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CCAUAGCAACUUGUAGGGCUG PVsiRNA-250010 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CGCUGGAUCGACAUGAUUAAG PVsiRNA-250011 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CUUCCAAGUCUCUGAAUACGCU PVsiRNA-250012 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CUUCCAAGUCUCUGAAUACGCU PVsiRNA-250013 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves GUAGAAUUGGUUGUUGAAAUC PVsiRNA-250014 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves GUAGAAUUGGUUGUUGAAAUC PVsiRNA-250015 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves GUAGAAUUGGUUGUUGAAAUC PVsiRNA-250016 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves GUAUUAACUUUGAUGAGCGCC PVsiRNA-250017 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UACAACUGUUGACGGCUGCCC PVsiRNA-250018 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UACACCGAUCUUUGACAAAGU PVsiRNA-250019 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UAGGUUUCCAAAGUGAUUUUG PVsiRNA-250020 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UAUCAACAUCCAGUUCGGCUGU PVsiRNA-250021 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UAUCAACAUCCAGUUCGGCUGU PVsiRNA-250022 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UAUUCCAACUGUCCAAGGACC PVsiRNA-250023 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UCAAACUUUACUAGAUCGGCC PVsiRNA-250024 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UCCAUAGCAACUUGUAGGGCU PVsiRNA-250025 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UCGCUGGAUCGACAUGAUUAAG PVsiRNA-250026 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UGAUAUUGGAGUGUAGUCACC PVsiRNA-250027 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UUACACCGAUCUUUGACAAAG PVsiRNA-250028 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UUACACCGAUCUUUGACAAAGU PVsiRNA-250029 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UUACUAGAUCGGCCAUUACAAA PVsiRNA-250030 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UUCCAUAGCAACUUGUAGGGCU PVsiRNA-250031 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UUGCGGAUUCCUCAUUGACAUU PVsiRNA-250032 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UUGCUGUAUAACUUGGCCCCA PVsiRNA-250033 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UUUUGUUGAGAACCUUGUAAAC PVsiRNA-250034 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UUUUGUUGAGAACCUUGUAAAC PVsiRNA-250279 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves CUCUUGGACUCACGUGACAUAC PVsiRNA-250280 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves UCUUGGACUCACGUGACAUACA PVsiRNA-250281 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves CUAGUGCUGAGUUUAUUGAACC PVsiRNA-250282 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves CACGGUGAAUGCAGAAGAACU PVsiRNA-250283 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves ACGGUGAAUGCAGAAGAACUAC PVsiRNA-250284 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves CGGUGAAUGCAGAAGAACUAC PVsiRNA-250285 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AGGAUGGCACUGUUAGAAAUC PVsiRNA-250286 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AGGAUGGCACUGUUAGAAAUCC PVsiRNA-250287 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves GGAUGGCACUGUUAGAAAUCC PVsiRNA-250288 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves CACUGUUAGAAAUCCUAUUCC PVsiRNA-250289 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AUGGAUACUGUUACAUUAACA PVsiRNA-250290 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves UACCGUGGGACAACUGAUAAAA PVsiRNA-250291 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves ACCGUGGGACAACUGAUAAAAU PVsiRNA-250292 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AACAGAUAAUAGAGGAAGAACC PVsiRNA-250293 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves ACAGAUAAUAGAGGAAGAACC PVsiRNA-250294 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves ACAUACUGGAUUGUCAAGAACC PVsiRNA-250295 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves ACUUCUGUGGUCUCACCUAGA PVsiRNA-250296 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AACACGAUCGGAAAUGAAUAAG PVsiRNA-250297 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AUCGGAAAUGAAUAAGGAACU PVsiRNA-250298 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AGAAAAAGCGUAGAUUUAGGC PVsiRNA-250299 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AAAAUGCGGACAGUGAUUAAC PVsiRNA-250300 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AAAUGCGGACAGUGAUUAACAC PVsiRNA-250301 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AAUGCGGACAGUGAUUAACAC PVsiRNA-250302 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AACCAUUGACACUAAGUACUG PVsiRNA-250303 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AACCUGACUAUAGAUUUUGAUA PVsiRNA-250304 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves CAGCGGAUACAUUUAGUAAUG PVsiRNA-250305 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AGCGGAUACAUUUAGUAAUGAC PVsiRNA-250306 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AAGAACAAUGAAGCAGAACACC PVsiRNA-250307 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AAGAGUUGGAAGGAACAAGCC PVsiRNA-250308 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AGAGUUGGAAGGAACAAGCCU PVsiRNA-250309 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AUUCCAGCGAUGAUCGCCACU PVsiRNA-250310 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AGAAUUUCGGAACUGCAUACA PVsiRNA-250311 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AGAAUUUCGGAACUGCAUACAC PVsiRNA-250312 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AGCACAUGUAUCGUAUCGGAGA PVsiRNA-250313 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves ACGGAGAUUUCUGGAAACACU PVsiRNA-250314 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AACGGACGAGGAUGAAAUAUUC PVsiRNA-250315 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AAUGUUAAAUAAGACUCGGACU PVsiRNA-250316 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves CUCGGACUUUUACAGCAGCACC PVsiRNA-250317 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves UCGGACUUUUACAGCAGCACC PVsiRNA-250318 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AUUAGAAACUUUACUUGGUGGC PVsiRNA-250319 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves GUUCGACAGCUCUUUGACACC PVsiRNA-250320 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves CAGCCGUCAACAGUUGUAGAC PVsiRNA-250321 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves GCACCAUAUAUCGCUGAAACUG PVsiRNA-250322 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AAGUGGAUCUGGAACAACGCC PVsiRNA-250323 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves GUGGAACAGGAACAAGAACACC PVsiRNA-250324 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves CAAUGUCGAAGAAAAUGCGCC PVsiRNA-250325 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves GUCGAAGAAAAUGCGCCUGCC PVsiRNA-250326 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves UUCGGUCUGGACGGAAAUGUC PVsiRNA-250327 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves ACGGAAAUGUCGGCGAGACUC PVsiRNA-250328 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AUAUGUACUUUUAGCGUGAACC PVsiRNA-250329 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves GUUGAGAGAGAAGAAUCAGAGA PVsiRNA-250330 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves CGUUGUUGACAUCUGGUUGCC PVsiRNA-250331 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AUCCCUGAUCAAUUUCGUGACG PVsiRNA-250332 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves ACCGUGCUGUAGCAUUUCGCA PVsiRNA-250333 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves CACCGUGCUGUAGCAUUUCGCA PVsiRNA-250334 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AGACUUUGUAGUUCUUCUGCAU PVsiRNA-250335 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves GAGACUUUGUAGUUCUUCUGCA PVsiRNA-250336 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves CAGAAACUAUUCGCUUGUGGAU PVsiRNA-250337 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AAUAGGAUUUCUAACAGUGCC PVsiRNA-250338 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves CAGUUCCAGAUCAUCAAUAUUG PVsiRNA-250339 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves UUGCUGUAUAACUUGGCCCCA PVsiRNA-250340 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AUUGCUGUAUAACUUGGCCCC PVsiRNA-250341 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AGAUUGCUGUAUAACUUGGCCC PVsiRNA-250342 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves GAUUGCUGUAUAACUUGGCCC PVsiRNA-250343 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AGAUUGCUGUAUAACUUGGCC PVsiRNA-250344 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves CAGAUUGCUGUAUAACUUGGC PVsiRNA-250345 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves UUACACCGAUCUUUGACAAAGU PVsiRNA-250346 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves UUACACCGAUCUUUGACAAAG PVsiRNA-250347 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves GUAUUAACUUUGAUGAGCGCCU PVsiRNA-250348 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AGUAUUAACUUUGAUGAGCGCC PVsiRNA-250349 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves GUAUUAACUUUGAUGAGCGCC PVsiRNA-250350 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves CGCUGGAUCGACAUGAUUAAG PVsiRNA-250351 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves UCGCUGGAUCGACAUGAUUAAG PVsiRNA-250352 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves UUCCGAUCGUGUUGUCAUGGCU PVsiRNA-250353 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves UUUCCGAUCGUGUUGUCAUGGC PVsiRNA-250354 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves UUCCGAUCGUGUUGUCAUGGC PVsiRNA-250355 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves UGAACACACGCCAUAUUGCUG PVsiRNA-250356 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves UCUGAACACACGCCAUAUUGCU PVsiRNA-250357 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AUGGCACAUUCUGUUCGAUUG PVsiRNA-250358 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AUUGACUGUUGGGAAUGGCACA PVsiRNA-250359 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves ACGAAGCAUUUCUUACUGGAUG PVsiRNA-250360 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves UCAAACUUUACUAGAUCGGCC PVsiRNA-250361 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves CCAUAGCAACUUGUAGGGCUG PVsiRNA-250362 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves UCCAUAGCAACUUGUAGGGCU PVsiRNA-250363 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves UUCCAUAGCAACUUGUAGGGCU PVsiRNA-250364 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves UUCCAUAGCAACUUGUAGGGC PVsiRNA-250365 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves CAUCAAUUCUGAAGGAUCUUGA PVsiRNA-250366 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AAUGAGAUUUGGGUUGUAAUGC PVsiRNA-250367 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves GUAGAAUUGGUUGUUGAAAUC PVsiRNA-250368 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AGUAGAAUUGGUUGUUGAAAUC PVsiRNA-250369 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves UAUUCCAACUGUCCAAGGACC PVsiRNA-250370 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves UUAUUCCAACUGUCCAAGGACC PVsiRNA-250371 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves UUCCAUGAAUUGUAAUCGAAUG PVsiRNA-250372 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves UACAACUGUUGACGGCUGCCC PVsiRNA-250373 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves UAGGUUUCCAAAGUGAUUUUG PVsiRNA-250374 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves ACAUGAACCAUAACUCUGACU PVsiRNA-250375 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves UGGCAUGUAUCGCUCUGUAGAG PVsiRNA-250376 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves CUUGGCAUGUAUCGCUCUGUAG PVsiRNA-250377 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AUAGUAAAUACGAGGUAGAACC PVsiRNA-250378 Maize Zea mays SCMV Sugarcane mosaic virus 24819114 Leaves AUAGUAAAUACGAGGUAGAAC