PVsiRNAdb Id Plant Scientific Name Virus Virus Name PMID Tissue Sequence PVsiRNA-249775 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAAGCCUUGUCGAGACUCUGC PVsiRNA-249776 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AACCACAGAUUGCAAGAGACC PVsiRNA-249777 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AACCCUGGGGCAAGUAGAUGCU PVsiRNA-249778 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AACCUGUGUACAUCCUUGAACA PVsiRNA-249779 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAGCCUUGUCGAGACUCUGCU PVsiRNA-249780 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACAGGGAAAAGACUUUGACAGU PVsiRNA-249781 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGAGGGUUUCUGAACUCAACG PVsiRNA-249782 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACUAAAUCUGAAGGAGCACCUG PVsiRNA-249783 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGAAUGACAUCAAGUCUUGGAC PVsiRNA-249784 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGCCAAUGAACUUACGGUUUG PVsiRNA-249785 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGCCUAAAUCGUAUACUAGUA PVsiRNA-249786 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGUUGACUCACGUCUUGCAUCC PVsiRNA-249787 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUACACAAUGGCGGCAAGUAGC PVsiRNA-249788 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUCCGGAAAGCCUUGUCGAGAC PVsiRNA-249789 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUUGGGCAAUUGCAUACUGGCC PVsiRNA-249790 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAAAAGAUCGACAUACACAAUG PVsiRNA-249791 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAACCACAGAUUGCAAGAGACC PVsiRNA-249792 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAACGUCCUGAUCUGUCCGGC PVsiRNA-249793 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACGAGGGUUUCUGAACUCAAC PVsiRNA-249794 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACUAAAUCUGAAGGAGCACC PVsiRNA-249795 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAGGGAAAAGACUUUGACAGU PVsiRNA-249796 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAGUUGACUCACGUCUUGCAUC PVsiRNA-249797 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAUCGCAAUCAGUUGGAAAAC PVsiRNA-249798 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAUGGACAACACGUACUUACG PVsiRNA-249799 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CCAUGGACAACACGUACUUACG PVsiRNA-249800 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CCGGAACAACCAGUCCUUCUG PVsiRNA-249801 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CGAAACAAGUUGACUCGGACU PVsiRNA-249802 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CGACAUGGUAACUGGAUACACU PVsiRNA-249803 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CGAGACUCUGCUUGACACGGA PVsiRNA-249804 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CUACGGAUUUGAAGUCAUAUC PVsiRNA-249805 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CUUGACGAAGACACAGGACACC PVsiRNA-249806 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves GCCGUGCGAUCUGAAGACAACC PVsiRNA-249807 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves GCCUUGUCGAGACUCUGCUUGA PVsiRNA-249808 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves GGCCAAAUCAAAAUCUCGUACU PVsiRNA-249809 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves GUAACUGGAUACACUUAACCCU PVsiRNA-249810 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves GUGUGUAGAUUCGUCCUGGCC PVsiRNA-249811 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves GUGUGUAGAUUCGUCCUGGCCU PVsiRNA-249812 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UAACCACUUCAAUUUCAACUG PVsiRNA-249813 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UAACCCUGGGGCAAGUAGAUGC PVsiRNA-249814 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UAAGAAAGCUGAUCCUGUACC PVsiRNA-249815 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UACAAUAGCUCUGAAGAACAGA PVsiRNA-249816 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UACACAAUGGCGGCAAGUAGC PVsiRNA-249817 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UAUCUGAGACCGGUUGAGCACC PVsiRNA-249818 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UCGAAACAAGUUGACUCGGACU PVsiRNA-249819 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UCGAGACUCUGCUUGACACGGA PVsiRNA-249820 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UGCGAUCUGAAGACAACCAUCG PVsiRNA-249821 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UGCUGACCAGAUUCUCGAGAUU PVsiRNA-249822 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UGUGUGUAGAUUCGUCCUGGCC PVsiRNA-249823 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UUGACGAAGACACAGGACACC PVsiRNA-249824 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UUGGGCAAUUGCAUACUGGCC PVsiRNA-249825 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAACACUUUGGAUUGGCAGGAC PVsiRNA-249826 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAGACAUUCGGGAAUUUCUGCC PVsiRNA-249827 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACACGGAGUACGAGAUUUUGA PVsiRNA-249828 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACACGGAGUACGAGAUUUUGAU PVsiRNA-249829 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACAGAUCAGGACGUUGUCAUC PVsiRNA-249830 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACCAGCCUGUAUACACCUGAAC PVsiRNA-249831 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGAUUUAGGCUCCCAAACACU PVsiRNA-249832 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACUAGUAUACGAUUUAGGCUCC PVsiRNA-249833 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGAACGUGUUUAGUCAGACAGU PVsiRNA-249834 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGACAUUCGGGAAUUUCUGCC PVsiRNA-249835 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGAUGAACAGAAUCGAGGAGAU PVsiRNA-249836 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGCAGAAUUUCGGACAUGGAGC PVsiRNA-249837 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGCCUGUAUACACCUGAACACA PVsiRNA-249838 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGGACCAAACUCACGGAUGAGA PVsiRNA-249839 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUACCGUGACGUUUGUUGAAUC PVsiRNA-249840 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUAGCCACAAUGAAUCGUCCUG PVsiRNA-249841 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUCGGAUUUUAGCUCCCACCU PVsiRNA-249842 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUGAACAGAAUCGAGGAGAUC PVsiRNA-249843 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUGCAGCAAACUGACCAGCCU PVsiRNA-249844 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAACGAUCUGUGAACAUAGCU PVsiRNA-249845 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACAAUGAAUCGUCCUGGGGA PVsiRNA-249846 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACAUCUGUGAUUGUGCUGCC PVsiRNA-249847 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACGGAGUACGAGAUUUUGAU PVsiRNA-249848 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACGGAGUACGAGAUUUUGAUU PVsiRNA-249849 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAGAAUUUCGGACAUGGAGCA PVsiRNA-249850 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CCAUUGUUGAUUAAUCUGGCU PVsiRNA-249851 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CCGCGAUUAUGAAUCUGCCACC PVsiRNA-249852 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CGAACUGCUAGCCGAACAUACC PVsiRNA-249853 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CGAGGACACAUGAAAUAUAUGC PVsiRNA-249854 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CGCGAUUAUGAAUCUGCCACC PVsiRNA-249855 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CGGACAGAUCAGGACGUUGUC PVsiRNA-249856 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CUACUAGUAUACGAUUUAGGCU PVsiRNA-249857 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CUAGUAUACGAUUUAGGCUCC PVsiRNA-249858 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CUGGAAUCUCGAGAAUCUGGUC PVsiRNA-249859 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves GAGGACACAUGAAAUAUAUGCC PVsiRNA-249860 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves GCAGAAUUUCGGACAUGGAGC PVsiRNA-249861 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves GUCCUGUGUCUUCGUCAAGAUG PVsiRNA-249862 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves GUUCCGCGAUUAUGAAUCUGCC PVsiRNA-249863 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UACCGUGACGUUUGUUGAAUC PVsiRNA-249864 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UACUAGUAUACGAUUUAGGCU PVsiRNA-249865 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UAGACAUACUCUUUCAAUGCCU PVsiRNA-249866 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UAGUAUACGAUUUAGGCUCCC PVsiRNA-249867 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UCGCACCGUUCGUAAGUACGUG PVsiRNA-249868 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UGAUCGGAUUUUAGCUCCCACC PVsiRNA-249869 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UGCAACGAUCUGUGAACAUAGC PVsiRNA-249870 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UGCAAGACGUGAGUCAACUGUA PVsiRNA-249871 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UGCAAGCAGAAUUUCGGACAUG PVsiRNA-249872 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UGUCGCACCGUUCGUAAGUACG PVsiRNA-249873 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UGUCUGAUCGAUCGAGUACACC PVsiRNA-249874 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UUCGAGUAGACAUCCACAGAC PVsiRNA-249875 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAAAUGCGGACAGUGAUUAAC PVsiRNA-249876 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAAUGCGGACAGUGAUUAACAC PVsiRNA-249877 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AACACGAUCGGAAAUGAAUAAG PVsiRNA-249878 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AACAGAUAAUAGAGGAAGAACC PVsiRNA-249879 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AACAGAUAAUAGAGGAAGAACC PVsiRNA-249880 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AACAGAUAAUAGAGGAAGAACC PVsiRNA-249881 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AACAGAUAAUAGAGGAAGAACC PVsiRNA-249882 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AACAGAUAAUAGAGGAAGAACC PVsiRNA-249883 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AACAGAUAAUAGAGGAAGAACC PVsiRNA-249884 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AACAGAUAAUAGAGGAAGAACC PVsiRNA-249885 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AACAGAUAAUAGAGGAAGAACC PVsiRNA-249886 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AACCAUUGACACUAAGUACUG PVsiRNA-249887 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AACGGACGAGGAUGAAAUAUU PVsiRNA-249888 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AACGGACGAGGAUGAAAUAUUC PVsiRNA-249889 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAGAGGAUGGCACUGUUAGAAA PVsiRNA-249890 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAGAGGAUGGCACUGUUAGAAA PVsiRNA-249891 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAGAGUUGGAAGGAACAAGCC PVsiRNA-249892 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAGUCGAGAUCGAGUCAGCUC PVsiRNA-249893 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAUGCGGACAGUGAUUAACAC PVsiRNA-249894 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAUUAUUUCGAAGCUGUGGACC PVsiRNA-249895 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAUUAUUUCGAAGCUGUGGACC PVsiRNA-249896 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACAGAUAAUAGAGGAAGAACC PVsiRNA-249897 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACAGAUAAUAGAGGAAGAACC PVsiRNA-249898 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACAGGAACAAGAACACCAUCU PVsiRNA-249899 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACAUACUGGAUUGUCAAGAACC PVsiRNA-249900 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACCCUGACAAGAUCUCUGAAU PVsiRNA-249901 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACCGUGGGACAACUGAUAAAAU PVsiRNA-249902 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGGAAAUGUCGGCGAGACUC PVsiRNA-249903 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGGACGAGGAUGAAAUAUUC PVsiRNA-249904 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGGACGAGGAUGAAAUAUUC PVsiRNA-249905 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGGACGAGGAUGAAAUAUUC PVsiRNA-249906 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGGACGAGGAUGAAAUAUUC PVsiRNA-249907 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGGACGAGGAUGAAAUAUUC PVsiRNA-249908 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGGACGAGGAUGAAAUAUUCC PVsiRNA-249909 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGGACGAGGAUGAAAUAUUCC PVsiRNA-249910 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGGACGAGGAUGAAAUAUUCC PVsiRNA-249911 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGGACGAGGAUGAAAUAUUCC PVsiRNA-249912 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGGACGAGGAUGAAAUAUUCC PVsiRNA-249913 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGGAGAUUUCUGGAAACACU PVsiRNA-249914 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGGUGAAUGCAGAAGAACUAC PVsiRNA-249915 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACUUCUGUGGUCUCACCUAGA PVsiRNA-249916 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGAAAAAGCGUAGAUUUAGGC PVsiRNA-249917 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGAGACAAAGACGUUGACGCU PVsiRNA-249918 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGAGUUGGAAGGAACAAGCCC PVsiRNA-249919 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGCAUGUGAUGGAAAUAGAACA PVsiRNA-249920 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGCGGAUACAUUUAGUAAUGAC PVsiRNA-249921 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGGAUGGCACUGUUAGAAAUC PVsiRNA-249922 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGGAUGGCACUGUUAGAAAUCC PVsiRNA-249923 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUCGGAAAUGAAUAAGGAACU PVsiRNA-249924 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUGGAUACUGUUACAUUAACA PVsiRNA-249925 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUUUCCAGAAGAUCAGAGACU PVsiRNA-249926 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUUUCCAGAAGAUCAGAGACU PVsiRNA-249927 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUUUCCAGAAGAUCAGAGACU PVsiRNA-249928 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUUUCCAGAAGAUCAGAGACU PVsiRNA-249929 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAAUGUCGAAGAAAAUGCGCC PVsiRNA-249930 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAAUGUCGAAGAAAAUGCGCC PVsiRNA-249931 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAAUGUCGAAGAAAAUGCGCC PVsiRNA-249932 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACGGUGAAUGCAGAAGAACU PVsiRNA-249933 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACUAGUCUCCUGGAAACCCU PVsiRNA-249934 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACUAGUCUCCUGGAAACCCU PVsiRNA-249935 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACUAGUCUCCUGGAAACCCU PVsiRNA-249936 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACUAGUCUCCUGGAAACCCU PVsiRNA-249937 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACUGAGAGUUGAUUUGACGCC PVsiRNA-249938 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACUGUUAGAAAUCCUAUUCC PVsiRNA-249939 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAGCCGUCAACAGUUGUAGAC PVsiRNA-249940 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAGCGGAUACAUUUAGUAAUG PVsiRNA-249941 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAUGGCUCACGGAGUGUAUUC PVsiRNA-249942 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CGGUCGAACUUACCUGAGCACC PVsiRNA-249943 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves GGAUGGCACUGUUAGAAAUCC PVsiRNA-249944 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UAACGGACGAGGAUGAAAUAUU PVsiRNA-249945 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UACCGUGGGACAACUGAUAAAA PVsiRNA-249946 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UAUUUCGAAGCUGUGGACCCA PVsiRNA-249947 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UCUUGGACUCACGUGACAUACA PVsiRNA-249948 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UUAUUUCGAAGCUGUGGACCC PVsiRNA-249949 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UUAUUUCGAAGCUGUGGACCCA PVsiRNA-249950 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UUUCCAGAAGAUCAGAGACUC PVsiRNA-249951 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AACGAGUCUCUGAUCUUCUGGA PVsiRNA-249952 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAGCCUGUGGAUUUUCCUGACC PVsiRNA-249953 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAGCCUGUGGAUUUUCCUGACC PVsiRNA-249954 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAGCCUGUGGAUUUUCCUGACC PVsiRNA-249955 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAGCCUGUGGAUUUUCCUGACC PVsiRNA-249956 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAGCCUGUGGAUUUUCCUGACC PVsiRNA-249957 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAGUGAAUCAUGCGUAGAAGUU PVsiRNA-249958 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAUAGGAUUUCUAACAGUGCC PVsiRNA-249959 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AAUGAGAUUUGGGUUGUAAUGC PVsiRNA-249960 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACAGAGAGUGCAUGUUGCGAC PVsiRNA-249961 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACCGUGCUGUAGCAUUUCGCA PVsiRNA-249962 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGAAGCAUUUCUUACUGGAUG PVsiRNA-249963 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves ACGAGUCUCUGAUCUUCUGGA PVsiRNA-249964 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGACUUUGUAGUUCUUCUGCAU PVsiRNA-249965 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGACUUUGUAGUUCUUCUGCAU PVsiRNA-249966 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGACUUUGUAGUUCUUCUGCAU PVsiRNA-249967 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGACUUUGUAGUUCUUCUGCAU PVsiRNA-249968 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGACUUUGUAGUUCUUCUGCAU PVsiRNA-249969 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGACUUUGUAGUUCUUCUGCAU PVsiRNA-249970 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGACUUUGUAGUUCUUCUGCAU PVsiRNA-249971 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGAUUGCUGUAUAACUUGGCC PVsiRNA-249972 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGAUUGCUGUAUAACUUGGCCC PVsiRNA-249973 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGCCUGUGGAUUUUCCUGACC PVsiRNA-249974 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGCCUGUGGAUUUUCCUGACCC PVsiRNA-249975 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGUAAAUACGAGGUAGAACCU PVsiRNA-249976 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGUAGAAUUGGUUGUUGAAAUC PVsiRNA-249977 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGUAGAAUUGGUUGUUGAAAUC PVsiRNA-249978 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGUAGAAUUGGUUGUUGAAAUC PVsiRNA-249979 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGUAGAAUUGGUUGUUGAAAUC PVsiRNA-249980 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGUAGAAUUGGUUGUUGAAAUC PVsiRNA-249981 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGUAGAAUUGGUUGUUGAAAUC PVsiRNA-249982 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGUAGAAUUGGUUGUUGAAAUC PVsiRNA-249983 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGUAGAAUUGGUUGUUGAAAUC PVsiRNA-249984 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGUAGAAUUGGUUGUUGAAAUC PVsiRNA-249985 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGUAUUAACUUUGAUGAGCGCC PVsiRNA-249986 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGUGAAUCAUGCGUAGAAGUU PVsiRNA-249987 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AGUUCCAGAUCAUCAAUAUUG PVsiRNA-249988 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUAGUAAAUACGAGGUAGAAC PVsiRNA-249989 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUAGUAAAUACGAGGUAGAACC PVsiRNA-249990 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUCCCUGAUCAAUUUCGUGACG PVsiRNA-249991 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUCCCUGAUCAAUUUCGUGACG PVsiRNA-249992 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUGGCACAUUCUGUUCGAUUG PVsiRNA-249993 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves AUUGCUGUAUAACUUGGCCCC PVsiRNA-249994 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACCAAGAACUUCCUCUGAUC PVsiRNA-249995 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACCAAGAACUUCCUCUGAUC PVsiRNA-249996 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACCAAGAACUUCCUCUGAUCC PVsiRNA-249997 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACCAAGAACUUCCUCUGAUCC PVsiRNA-249998 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACCAAGAACUUCCUCUGAUCC PVsiRNA-249999 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACCAAGAACUUCCUCUGAUCC PVsiRNA-250000 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACCGUGCUGUAGCAUUUCGCA PVsiRNA-250001 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CACCGUGCUGUAGCAUUUCGCA PVsiRNA-250002 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAGAUUGCUGUAUAACUUGGC PVsiRNA-250003 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAGUUCCAGAUCAUCAAUAUUG PVsiRNA-250004 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAGUUCCAGAUCAUCAAUAUUG PVsiRNA-250005 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAGUUCCAGAUCAUCAAUAUUG PVsiRNA-250006 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAGUUCCAGAUCAUCAAUAUUG PVsiRNA-250007 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CAGUUCCAGAUCAUCAAUAUUG PVsiRNA-250008 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CCAUAGCAACUUGUAGGGCUG PVsiRNA-250009 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CCAUAGCAACUUGUAGGGCUG PVsiRNA-250010 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CGCUGGAUCGACAUGAUUAAG PVsiRNA-250011 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CUUCCAAGUCUCUGAAUACGCU PVsiRNA-250012 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves CUUCCAAGUCUCUGAAUACGCU PVsiRNA-250013 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves GUAGAAUUGGUUGUUGAAAUC PVsiRNA-250014 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves GUAGAAUUGGUUGUUGAAAUC PVsiRNA-250015 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves GUAGAAUUGGUUGUUGAAAUC PVsiRNA-250016 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves GUAUUAACUUUGAUGAGCGCC PVsiRNA-250017 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UACAACUGUUGACGGCUGCCC PVsiRNA-250018 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UACACCGAUCUUUGACAAAGU PVsiRNA-250019 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UAGGUUUCCAAAGUGAUUUUG PVsiRNA-250020 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UAUCAACAUCCAGUUCGGCUGU PVsiRNA-250021 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UAUCAACAUCCAGUUCGGCUGU PVsiRNA-250022 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UAUUCCAACUGUCCAAGGACC PVsiRNA-250023 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UCAAACUUUACUAGAUCGGCC PVsiRNA-250024 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UCCAUAGCAACUUGUAGGGCU PVsiRNA-250025 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UCGCUGGAUCGACAUGAUUAAG PVsiRNA-250026 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UGAUAUUGGAGUGUAGUCACC PVsiRNA-250027 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UUACACCGAUCUUUGACAAAG PVsiRNA-250028 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UUACACCGAUCUUUGACAAAGU PVsiRNA-250029 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UUACUAGAUCGGCCAUUACAAA PVsiRNA-250030 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UUCCAUAGCAACUUGUAGGGCU PVsiRNA-250031 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UUGCGGAUUCCUCAUUGACAUU PVsiRNA-250032 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UUGCUGUAUAACUUGGCCCCA PVsiRNA-250033 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UUUUGUUGAGAACCUUGUAAAC PVsiRNA-250034 Maize Zea mays MCMV+SCMV Maize chlorotic mottle virus and Sugarcane mosaic virus 26864602 Leaves UUUUGUUGAGAACCUUGUAAAC