PVsiRNAdb Id Plant Scientific Name Virus Virus Name PMID Tissue Sequence PVsiRNA-228133 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves GGUUUGAUAAAGCUAGUCCUU PVsiRNA-228134 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves GGUUUGAUAAAGCUAGUCCUU PVsiRNA-228135 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves AGUUCAGUAGAUCUGC PVsiRNA-228136 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves AGUUCAGUAGAUCUGCA PVsiRNA-228137 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves AACGCGACUUUUUAUCUGUCA PVsiRNA-228138 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves AACGCGACUUUUUAUCUGUCA PVsiRNA-228139 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves GAAAGUUCAGUAGAUCUGCAGA PVsiRNA-228140 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves UAAUCGAGAAUCAUGAUAAGU PVsiRNA-228141 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves AAUGAAACGGAUGUUAAACGU PVsiRNA-228142 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves GGUGAUGAAACCUAAUUCAGA PVsiRNA-228143 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves GGUGAUGAAACCUAAUUCAGA PVsiRNA-228144 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves GGUGAUGAAACCUAAUUCAGA PVsiRNA-228145 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves AAUUGGAUCCAAGUAAAAACU PVsiRNA-228146 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves UUCUGAGAUUUUAAUGUACUU PVsiRNA-228147 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves UUCUGAGAUUUUAAUGUACUU PVsiRNA-228148 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves UUUAGAAAAUAUGUUGAACCU PVsiRNA-228149 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves UUCUGAGAUUUUAAUGUACUUU PVsiRNA-228150 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves UUCUGAGAUUUUAAUGUACUUU PVsiRNA-228151 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves AACUUGUCAUUUCGUCCAUUCG PVsiRNA-228152 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves GUUUUUAUUGGUGAACUUCCU PVsiRNA-228153 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves UGCUUGAUCAGGAGAUAGGAGA PVsiRNA-228154 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves GUCGGUUGGAAUUUUACUUAU PVsiRNA-228155 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves GAUUUGGUCGUCGUAGAGCCU PVsiRNA-228156 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves UUGCCAAUUCUGAACCGUGAAU PVsiRNA-228157 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves AUGGCUUGAGAUCAGAAGUUC PVsiRNA-228158 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves AAGUUAUUCCAGUUAUCAUCA PVsiRNA-228159 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves AGACAUUCUAGUAUUACUUGA PVsiRNA-228160 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves UCCGACCGAAGAAGACUGGAA PVsiRNA-228161 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves AGACAUUCUAGUAUUACUUGAA PVsiRNA-228162 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves AAGUAAACGUGCAGGCUCUCA PVsiRNA-228163 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves AGUGAAUUCGAAUAUAA PVsiRNA-228164 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves AUCUGACAUUCUUUGGCACCA PVsiRNA-228165 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves UUCUCGAUUCAGUUUUUCUCA PVsiRNA-228166 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves AACCACGUAUUUGAGAAAGCU PVsiRNA-228167 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves AUUGUCUUGUUCCCCUCGAGUA PVsiRNA-228168 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves UUGCCAAUUCUGAACCGUGAA PVsiRNA-228169 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves AAGGUUGUAGAACUAAGCCCA PVsiRNA-228170 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves AAACUUAUAAACGACCAAGAA PVsiRNA-228171 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves UGACUACUUUUGGACUAAGCU PVsiRNA-228172 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves UUCUGAGAUUUUAAUGUACUU PVsiRNA-228173 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves UUGGGCAUUAUUAUAUUUAGA PVsiRNA-228174 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves UUGGGCAUUAUUAUAUUUAGA PVsiRNA-228175 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves UUGGGCAUUAUUAUAUUUAGA PVsiRNA-228176 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves UCUGAGUAAAUGAAUCAUUCU PVsiRNA-228177 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves UUCUGAGAUUUUAAUGUACUUU PVsiRNA-228178 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves GCUAAAACCUCAAACAGCAAAU PVsiRNA-228179 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves AGAUUGCUCAUUCAGGUCAAU PVsiRNA-228180 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves UCUCUAGUGCUUUCGUUUAAA PVsiRNA-228181 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves UUCUGAGAUUUUAAUGUACUUU PVsiRNA-228182 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves AAUCGAGAAUCAUGAUAAGU PVsiRNA-228183 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves GUUUUUAUUGGUGAACUUCCU PVsiRNA-228184 Rice Oryza sativa RBSDV Rice black streaked dwarf virus 29215744 Shoots and Leaves AAGGUUGUAGAACUAAGCCCA