PVsiRNAdb Id	Plant	Scientific Name	Virus	Virus Name	PMID	Tissue	Sequence
PVsiRNA-228133	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	GGUUUGAUAAAGCUAGUCCUU	
PVsiRNA-228134	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	GGUUUGAUAAAGCUAGUCCUU	
PVsiRNA-228135	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	AGUUCAGUAGAUCUGC	
PVsiRNA-228136	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	AGUUCAGUAGAUCUGCA	
PVsiRNA-228137	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	AACGCGACUUUUUAUCUGUCA	
PVsiRNA-228138	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	AACGCGACUUUUUAUCUGUCA	
PVsiRNA-228139	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	GAAAGUUCAGUAGAUCUGCAGA	
PVsiRNA-228140	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	UAAUCGAGAAUCAUGAUAAGU	
PVsiRNA-228141	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	AAUGAAACGGAUGUUAAACGU	
PVsiRNA-228142	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	GGUGAUGAAACCUAAUUCAGA	
PVsiRNA-228143	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	GGUGAUGAAACCUAAUUCAGA	
PVsiRNA-228144	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	GGUGAUGAAACCUAAUUCAGA	
PVsiRNA-228145	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	AAUUGGAUCCAAGUAAAAACU	
PVsiRNA-228146	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	UUCUGAGAUUUUAAUGUACUU	
PVsiRNA-228147	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	UUCUGAGAUUUUAAUGUACUU	
PVsiRNA-228148	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	UUUAGAAAAUAUGUUGAACCU	
PVsiRNA-228149	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	UUCUGAGAUUUUAAUGUACUUU	
PVsiRNA-228150	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	UUCUGAGAUUUUAAUGUACUUU	
PVsiRNA-228151	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	AACUUGUCAUUUCGUCCAUUCG	
PVsiRNA-228152	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	GUUUUUAUUGGUGAACUUCCU	
PVsiRNA-228153	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	UGCUUGAUCAGGAGAUAGGAGA	
PVsiRNA-228154	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	GUCGGUUGGAAUUUUACUUAU	
PVsiRNA-228155	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	GAUUUGGUCGUCGUAGAGCCU	
PVsiRNA-228156	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	UUGCCAAUUCUGAACCGUGAAU	
PVsiRNA-228157	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	AUGGCUUGAGAUCAGAAGUUC	
PVsiRNA-228158	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	AAGUUAUUCCAGUUAUCAUCA	
PVsiRNA-228159	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	AGACAUUCUAGUAUUACUUGA	
PVsiRNA-228160	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	UCCGACCGAAGAAGACUGGAA	
PVsiRNA-228161	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	AGACAUUCUAGUAUUACUUGAA	
PVsiRNA-228162	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	AAGUAAACGUGCAGGCUCUCA	
PVsiRNA-228163	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	AGUGAAUUCGAAUAUAA	
PVsiRNA-228164	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	AUCUGACAUUCUUUGGCACCA	
PVsiRNA-228165	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	UUCUCGAUUCAGUUUUUCUCA	
PVsiRNA-228166	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	AACCACGUAUUUGAGAAAGCU	
PVsiRNA-228167	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	AUUGUCUUGUUCCCCUCGAGUA	
PVsiRNA-228168	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	UUGCCAAUUCUGAACCGUGAA	
PVsiRNA-228169	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	AAGGUUGUAGAACUAAGCCCA	
PVsiRNA-228170	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	AAACUUAUAAACGACCAAGAA	
PVsiRNA-228171	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	UGACUACUUUUGGACUAAGCU	
PVsiRNA-228172	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	UUCUGAGAUUUUAAUGUACUU	
PVsiRNA-228173	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	UUGGGCAUUAUUAUAUUUAGA	
PVsiRNA-228174	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	UUGGGCAUUAUUAUAUUUAGA	
PVsiRNA-228175	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	UUGGGCAUUAUUAUAUUUAGA	
PVsiRNA-228176	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	UCUGAGUAAAUGAAUCAUUCU	
PVsiRNA-228177	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	UUCUGAGAUUUUAAUGUACUUU	
PVsiRNA-228178	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	GCUAAAACCUCAAACAGCAAAU	
PVsiRNA-228179	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	AGAUUGCUCAUUCAGGUCAAU	
PVsiRNA-228180	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	UCUCUAGUGCUUUCGUUUAAA	
PVsiRNA-228181	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	UUCUGAGAUUUUAAUGUACUUU	
PVsiRNA-228182	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	AAUCGAGAAUCAUGAUAAGU	
PVsiRNA-228183	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	GUUUUUAUUGGUGAACUUCCU	
PVsiRNA-228184	Rice	Oryza sativa	RBSDV	Rice black streaked dwarf virus	29215744	Shoots and Leaves	AAGGUUGUAGAACUAAGCCCA	
PVsiRNA-249341	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AUACAACAACUAGAACAAUGGC	
PVsiRNA-249342	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UAGAACUACAGGAACUGACGGA	
PVsiRNA-249343	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UACAACAACUAGAACAAUGGCA	
PVsiRNA-249344	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCUGAACCGUGAAUCUGAAGAA	
PVsiRNA-249345	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	ACAACAACUAGAACAAUGGCAA	
PVsiRNA-249346	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAAAGAAGGAAUGAGCGU	
PVsiRNA-249347	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AGAGAAUGGCAGACCAAGAGCG	
PVsiRNA-249348	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCAGUUGGCAGAAGAAGAAGU	
PVsiRNA-249349	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AGAAGACUGGAAGUUUUGCAUG	
PVsiRNA-249350	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCUGAAAGAAGGAAUGAGCGUA	
PVsiRNA-249351	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AGAAUUGGGAUUUGGUCGUCGU	
PVsiRNA-249352	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UACAACAACUAGAACAAUGGC	
PVsiRNA-249353	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AGAUGACUGGCACCCAUGACGA	
PVsiRNA-249354	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAGUGAAGAAUUUGUAGGUGUG	
PVsiRNA-249355	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AGAGCGACAAGAAGAAUCGAA	
PVsiRNA-249356	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AGAAGACUGGAAGUUUUGCAU	
PVsiRNA-249357	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AGAACUACAGGAACUGACGGAU	
PVsiRNA-249358	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAGUAAACGUGCAGGCUCUCA	
PVsiRNA-249359	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGGGAAUUGACGAUGACGACUG	
PVsiRNA-249360	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AGAACUACAGGAACUGACGGA	
PVsiRNA-249361	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UAGGAGAAGAGUGGUGUGACAU	
PVsiRNA-249362	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAAAUUGUGACUUCGGACGGUU	
PVsiRNA-249363	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AACCAAUCUUCAGACGUGCUUA	
PVsiRNA-249364	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GAACUACAGGAACUGACGGAU	
PVsiRNA-249365	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAACCGUGAAUCUGAAGA	
PVsiRNA-249366	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCGGAAUCUAUAAUAAGACGUC	
PVsiRNA-249367	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGCAACACUUGUAGAAAAGCAC	
PVsiRNA-249368	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GCUGAACAAAUAGAACGUGUA	
PVsiRNA-249369	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGCUGAACAAAUAGAACGUGUA	
PVsiRNA-249370	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UAGAACUACAGGAACUGACGG	
PVsiRNA-249371	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUGUGACUUCGGACGGUUCCAG	
PVsiRNA-249372	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UAGUUGUCAACUGUAAUCACGG	
PVsiRNA-249373	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAGGACAUCUCAAACAAUCAGA	
PVsiRNA-249374	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCUGAACCGUGAAUCUGAAGA	
PVsiRNA-249375	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGGAAAAAGAUGUAGCAAGAG	
PVsiRNA-249376	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	ACAGGUGACGAAACAACGGAUG	
PVsiRNA-249377	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCAGUUGGCAGAAGAAGAAGUU	
PVsiRNA-249378	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUUUGUUGGCAUACUUACUAUU	
PVsiRNA-249379	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AGUUGUCAACUGUAAUCACGG	
PVsiRNA-249380	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAGAGAAUGGCAGACCAAGAGC	
PVsiRNA-249381	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAAGAUGACUGGCACCCAUGAC	
PVsiRNA-249382	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAACAAAGCGAAAACGUG	
PVsiRNA-249383	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUAGAACUACAGGAACUGACGG	
PVsiRNA-249384	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGUGAUAACAGAAUGACGGCC	
PVsiRNA-249385	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAUGAAUUCUGAGGAGAAACGA	
PVsiRNA-249386	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAAAUUGAUGAUCGCGUA	
PVsiRNA-249387	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGUGACUUCGGACGGUUCCAGU	
PVsiRNA-249388	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGACGAAACAACGGAUGAGUAU	
PVsiRNA-249389	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGGAAAAAGAUGUAGCAAGAGU	
PVsiRNA-249390	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGAACAGGGAUGGAUCCAGGAC	
PVsiRNA-249391	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AUGAACUGAAGAUCGCACAGCA	
PVsiRNA-249392	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UAAUGAACUGAAGAUCGCACA	
PVsiRNA-249393	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGAACUGAAGAUCGCACAGCAC	
PVsiRNA-249394	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GAUAAUGAACUGAAGAUCGCA	
PVsiRNA-249395	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGAACUGAAGAUCGCACAGCA	
PVsiRNA-249396	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCGAUAAUGAACUGAAGAUCGC	
PVsiRNA-249397	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGAGAAUUCUAAUUUCGUUGGU	
PVsiRNA-249398	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UAAAGAUUGGGACGUAGAUGGC	
PVsiRNA-249399	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GAUGAAAAGACAGGCAACUCAG	
PVsiRNA-249400	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	CGGGAAAGGUAAGAAAUAGCAU	
PVsiRNA-249401	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAAGACAGGCAACUCAGUAGGA	
PVsiRNA-249402	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	CGAUAAUGAACUGAAGAUCGCA	
PVsiRNA-249403	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUGGAAGAAGAAACGUUGGCG	
PVsiRNA-249404	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCAGAAGUAGAGUAACCGUGA	
PVsiRNA-249405	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	ACUUGAUUGUAUAGCGUUCGGA	
PVsiRNA-249406	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAGGACUAGAAGCAGAGGUGCC	
PVsiRNA-249407	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAAGGACUAGAAGCAGAGGUG	
PVsiRNA-249408	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAAAGACAGGCAACUCAGUAGG	
PVsiRNA-249409	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCGGUUUCUGAUGAUGGUUUA	
PVsiRNA-249410	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCCUGAUCAAGCAACUCAGCAA	
PVsiRNA-249411	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AGCAAUGGAGAACAGAUCGGCA	
PVsiRNA-249412	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AUCAAUACCAUAAGAUCGUUGA	
PVsiRNA-249413	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AGGACUAGAAGCAGAGGUGCC	
PVsiRNA-249414	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAAAGACAGGCAACUCAGUAG	
PVsiRNA-249415	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AGGGACUACUGAGUCGCGGGUC	
PVsiRNA-249416	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAAGAUUGGGACGUAGAUGGC	
PVsiRNA-249417	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	CUUGAUUGUAUAGCGUUCGGA	
PVsiRNA-249418	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	CGAUAAUGAACUGAAGAUCGC	
PVsiRNA-249419	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GAUAAUGAACUGAAGAUCGCAC	
PVsiRNA-249420	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAAGGACUAGAAGCAGAGGUGC	
PVsiRNA-249421	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AGGAGCAGAACGAUACAUCGAA	
PVsiRNA-249422	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAGCACUAGAGAACAAUUACUG	
PVsiRNA-249423	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AUGAACAAUGAAGACUGGACAU	
PVsiRNA-249424	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAAGACAGGCAACUCAGUAGG	
PVsiRNA-249425	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAAGAUUGGGACGUAGAUGGCG	
PVsiRNA-249426	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCGGUCGGACAAUACACAAAU	
PVsiRNA-249427	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GAAAAGACAGGCAACUCAGUAG	
PVsiRNA-249428	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCAAUACCAUAAGAUCGUUGAG	
PVsiRNA-249429	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAUGAACAAUGAAGACUGGACA	
PVsiRNA-249430	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCUAGAAUUGGAAGACGCGUU	
PVsiRNA-249431	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUGAUUGUAUAGCGUUCGGAA	
PVsiRNA-249432	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	ACACAAUGAACAAUGAAGACUG	
PVsiRNA-249433	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCAAUGUUUGUUGGGCGGCUAC	
PVsiRNA-249434	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAGGAGCAGAACGAUACAUCGA	
PVsiRNA-249435	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UAGCAGAGUGAUUGUUGGUCGG	
PVsiRNA-249436	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGACUGUGAAUUUAGGAGGAGA	
PVsiRNA-249437	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAGAUUGGGACGUAGAUGGCG	
PVsiRNA-249438	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AACAAGACAAUGUAGACUGUA	
PVsiRNA-249439	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGGAUGAUGAAACGAGUAU	
PVsiRNA-249440	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGACAGAAGACUGAUGACACAU	
PVsiRNA-249441	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCCGAACGCUAUACAAUCAAGU	
PVsiRNA-249442	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCCGAACGCUAUACAAUCAAGU	
PVsiRNA-249443	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCAACGAUCUUAUGGUAUUGAU	
PVsiRNA-249444	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCAACGAUCUUAUGGUAUUGAU	
PVsiRNA-249445	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCAACGAUCUUAUGGUAUUGAU	
PVsiRNA-249446	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCAACGAUCUUAUGGUAUUGAU	
PVsiRNA-249447	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCAACGAUCUUAUGGUAUUGAU	
PVsiRNA-249448	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCAACGAUCUUAUGGUAUUGAU	
PVsiRNA-249449	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	CUCAACGAUCUUAUGGUAUUGA	
PVsiRNA-249450	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	CUCAACGAUCUUAUGGUAUUGA	
PVsiRNA-249451	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	CUCAACGAUCUUAUGGUAUUGA	
PVsiRNA-249452	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	CUCAACGAUCUUAUGGUAUUGA	
PVsiRNA-249453	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCGGAAUCUAUAAUAAGACGUC	
PVsiRNA-249454	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCGGAAUCUAUAAUAAGACGUC	
PVsiRNA-249455	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCGGAAUCUAUAAUAAGACGUC	
PVsiRNA-249456	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGCUGUGCGAUCUUCAGUUCAU	
PVsiRNA-249457	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGCUGUGCGAUCUUCAGUUCAU	
PVsiRNA-249458	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGCUGUGCGAUCUUCAGUUCAU	
PVsiRNA-249459	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGCUGUGCGAUCUUCAGUUCAU	
PVsiRNA-249460	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGCUGUGCGAUCUUCAGUUCAU	
PVsiRNA-249461	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGCUGUGCGAUCUUCAGUUCAU	
PVsiRNA-249462	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGCUGUGCGAUCUUCAGUUCAU	
PVsiRNA-249463	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGUGCGAUCUUCAGUUCAUUA	
PVsiRNA-249464	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGUGCGAUCUUCAGUUCAUUA	
PVsiRNA-249465	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGUGCGAUCUUCAGUUCAUUA	
PVsiRNA-249466	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GUGCUGUGCGAUCUUCAGUUCA	
PVsiRNA-249467	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GUGCUGUGCGAUCUUCAGUUCA	
PVsiRNA-249468	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GUGCUGUGCGAUCUUCAGUUCA	
PVsiRNA-249469	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GUGCUGUGCGAUCUUCAGUUCA	
PVsiRNA-249470	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGCGAUCUUCAGUUCAUUAUC	
PVsiRNA-249471	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGCGAUCUUCAGUUCAUUAUCG	
PVsiRNA-249472	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGCGAUCUUCAGUUCAUUAUCG	
PVsiRNA-249473	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGCGAUCUUCAGUUCAUUAUCG	
PVsiRNA-249474	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGCGAUCUUCAGUUCAUUAUCG	
PVsiRNA-249475	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGCGAUCUUCAGUUCAUUAUCG	
PVsiRNA-249476	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	CGCCAACGUUUCUUCUUCCAA	
PVsiRNA-249477	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GGCACCUCUGCUUCUAGUCCUU	
PVsiRNA-249478	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GGCACCUCUGCUUCUAGUCCUU	
PVsiRNA-249479	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GGCACCUCUGCUUCUAGUCCUU	
PVsiRNA-249480	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GGCACCUCUGCUUCUAGUCCUU	
PVsiRNA-249481	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	CACCUCUGCUUCUAGUCCUUU	
PVsiRNA-249482	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GCGAUCUUCAGUUCAUUAUCG	
PVsiRNA-249483	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GCGAUCUUCAGUUCAUUAUCG	
PVsiRNA-249484	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GCGAUCUUCAGUUCAUUAUCG	
PVsiRNA-249485	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GCGAUCUUCAGUUCAUUAUCG	
PVsiRNA-249486	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GUGCGAUCUUCAGUUCAUUAUC	
PVsiRNA-249487	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GUGCGAUCUUCAGUUCAUUAUC	
PVsiRNA-249488	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GUGCGAUCUUCAGUUCAUUAUC	
PVsiRNA-249489	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GCACCUCUGCUUCUAGUCCUUU	
PVsiRNA-249490	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GCACCUCUGCUUCUAGUCCUUU	
PVsiRNA-249491	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GCACCUCUGCUUCUAGUCCUUU	
PVsiRNA-249492	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GCACCUCUGCUUCUAGUCCUUU	
PVsiRNA-249493	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GCACCUCUGCUUCUAGUCCUUU	
PVsiRNA-249494	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GCACCUCUGCUUCUAGUCCUUU	
PVsiRNA-249495	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GCACCUCUGCUUCUAGUCCUUU	
PVsiRNA-249496	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GCACCUCUGCUUCUAGUCCUUU	
PVsiRNA-249497	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	CCGACCAACAAUCACUCUGCUA	
PVsiRNA-249498	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	CCGACCAACAAUCACUCUGCUA	
PVsiRNA-249499	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	CCGACCAACAAUCACUCUGCUA	
PVsiRNA-249500	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAGUGAAGAAUUUGUAGGUGUG	
PVsiRNA-249501	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAGUGAAGAAUUUGUAGGUGUG	
PVsiRNA-249502	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGCUGAACAAAUAGAACGUGUA	
PVsiRNA-249503	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AACGCGUCUUCCAAUUCUAGA	
PVsiRNA-249504	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AUACUCGUUUCAUCAUCCAGAA	
PVsiRNA-249505	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AUACUCGUUUCAUCAUCCAGAA	
PVsiRNA-249506	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AUACUCGUUUCAUCAUCCAGAA	
PVsiRNA-249507	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AUACUCGUUUCAUCAUCCAGAA	
PVsiRNA-249508	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AUACUCGUUUCAUCAUCCAGAA	
PVsiRNA-249509	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UAGAACUACAGGAACUGACGGA	
PVsiRNA-249510	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AGAAGACUGGAAGUUUUGCAUG	
PVsiRNA-249511	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AGAAGACUGGAAGUUUUGCAUG	
PVsiRNA-249512	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AGAAGACUGGAAGUUUUGCAUG	
PVsiRNA-249513	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AGAAGACUGGAAGUUUUGCAUG	
PVsiRNA-249514	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AGAAGACUGGAAGUUUUGCAUG	
PVsiRNA-249515	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AGAAGACUGGAAGUUUUGCAUG	
PVsiRNA-249516	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AGAAGACUGGAAGUUUUGCAUG	
PVsiRNA-249517	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GAACUACAGGAACUGACGGAU	
PVsiRNA-249518	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GAACUACAGGAACUGACGGAU	
PVsiRNA-249519	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAGGACAUCUCAAACAAUCAGA	
PVsiRNA-249520	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAGGACAUCUCAAACAAUCAGA	
PVsiRNA-249521	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUAGAACUACAGGAACUGACGG	
PVsiRNA-249522	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUAGAACUACAGGAACUGACGG	
PVsiRNA-249523	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUAGAACUACAGGAACUGACGG	
PVsiRNA-249524	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGUGAUAACAGAAUGACGGCC	
PVsiRNA-249525	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAUGAAUUCUGAGGAGAAACGA	
PVsiRNA-249526	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAUGAAUUCUGAGGAGAAACGA	
PVsiRNA-249527	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AUGCUAUUUCUUACCUUUCCCG	
PVsiRNA-249528	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AUGCUAUUUCUUACCUUUCCCG	
PVsiRNA-249529	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCUCCUCCUAAAUUCACAGUCA	
PVsiRNA-249530	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAGUAAACGUGCAGGCUCUCA	
PVsiRNA-249531	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	CAGUAAUUGUUCUCUAGUGCUU	
PVsiRNA-249532	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	CAGUAAUUGUUCUCUAGUGCUU	
PVsiRNA-249533	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	CAGUAAUUGUUCUCUAGUGCUU	
PVsiRNA-249534	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AUGUGUCAUCAGUCUUCUGUCA	
PVsiRNA-249535	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AUACAACAACUAGAACAAUGGC	
PVsiRNA-249536	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AUACAACAACUAGAACAAUGGC	
PVsiRNA-249537	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AUACAACAACUAGAACAAUGGC	
PVsiRNA-249538	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AUACAACAACUAGAACAAUGGC	
PVsiRNA-249539	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AUACAACAACUAGAACAAUGGC	
PVsiRNA-249540	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AUACAACAACUAGAACAAUGGC	
PVsiRNA-249541	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AUACAACAACUAGAACAAUGGC	
PVsiRNA-249542	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AUACAACAACUAGAACAAUGGC	
PVsiRNA-249543	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UACAACAACUAGAACAAUGGCA	
PVsiRNA-249544	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UACAACAACUAGAACAAUGGCA	
PVsiRNA-249545	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UACAACAACUAGAACAAUGGCA	
PVsiRNA-249546	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UACAACAACUAGAACAAUGGCA	
PVsiRNA-249547	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UACAACAACUAGAACAAUGGCA	
PVsiRNA-249548	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UACAACAACUAGAACAAUGGCA	
PVsiRNA-249549	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UACAACAACUAGAACAAUGGCA	
PVsiRNA-249550	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	ACAACAACUAGAACAAUGGCAA	
PVsiRNA-249551	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	ACAACAACUAGAACAAUGGCAA	
PVsiRNA-249552	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	ACAACAACUAGAACAAUGGCAA	
PVsiRNA-249553	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	ACAACAACUAGAACAAUGGCAA	
PVsiRNA-249554	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	ACAACAACUAGAACAAUGGCAA	
PVsiRNA-249555	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	ACAACAACUAGAACAAUGGCAA	
PVsiRNA-249556	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	ACAACAACUAGAACAAUGGCAA	
PVsiRNA-249557	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCAGUUGGCAGAAGAAGAAGU	
PVsiRNA-249558	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCAGUUGGCAGAAGAAGAAGU	
PVsiRNA-249559	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCAGUUGGCAGAAGAAGAAGU	
PVsiRNA-249560	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCAGUUGGCAGAAGAAGAAGU	
PVsiRNA-249561	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AGAAUUGGGAUUUGGUCGUCGU	
PVsiRNA-249562	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AGAAUUGGGAUUUGGUCGUCGU	
PVsiRNA-249563	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AGAAUUGGGAUUUGGUCGUCGU	
PVsiRNA-249564	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AGAAUUGGGAUUUGGUCGUCGU	
PVsiRNA-249565	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AGAAUUGGGAUUUGGUCGUCGU	
PVsiRNA-249566	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AGAAUUGGGAUUUGGUCGUCGU	
PVsiRNA-249567	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UACAACAACUAGAACAAUGGC	
PVsiRNA-249568	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UACAACAACUAGAACAAUGGC	
PVsiRNA-249569	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UACAACAACUAGAACAAUGGC	
PVsiRNA-249570	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAAAUUGUGACUUCGGACGGUU	
PVsiRNA-249571	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAAAUUGUGACUUCGGACGGUU	
PVsiRNA-249572	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAAAUUGUGACUUCGGACGGUU	
PVsiRNA-249573	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AACCAAUCUUCAGACGUGCUUA	
PVsiRNA-249574	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AACCAAUCUUCAGACGUGCUUA	
PVsiRNA-249575	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AACCAAUCUUCAGACGUGCUUA	
PVsiRNA-249576	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AACCAAUCUUCAGACGUGCUUA	
PVsiRNA-249577	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGGAAAAAGAUGUAGCAAGAG	
PVsiRNA-249578	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGGAAAAAGAUGUAGCAAGAG	
PVsiRNA-249579	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGGAAAAAGAUGUAGCAAGAG	
PVsiRNA-249580	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGGAAAAAGAUGUAGCAAGAG	
PVsiRNA-249581	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCAGUUGGCAGAAGAAGAAGUU	
PVsiRNA-249582	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCAGUUGGCAGAAGAAGAAGUU	
PVsiRNA-249583	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGUGACUUCGGACGGUUCCAGU	
PVsiRNA-249584	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGGAAAAAGAUGUAGCAAGAGU	
PVsiRNA-249585	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGGAAAAAGAUGUAGCAAGAGU	
PVsiRNA-249586	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGGAAAAAGAUGUAGCAAGAGU	
PVsiRNA-249587	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGGAAAAAGAUGUAGCAAGAGU	
PVsiRNA-249588	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGGAAAAAGAUGUAGCAAGAGU	
PVsiRNA-249589	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGGAAAAAGAUGUAGCAAGAGU	
PVsiRNA-249590	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGGAAAAAGAUGUAGCAAGAGU	
PVsiRNA-249591	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGAACAGGGAUGGAUCCAGGAC	
PVsiRNA-249592	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGAACAGGGAUGGAUCCAGGAC	
PVsiRNA-249593	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGAACAGGGAUGGAUCCAGGAC	
PVsiRNA-249594	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGAACAGGGAUGGAUCCAGGAC	
PVsiRNA-249595	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGAACAGGGAUGGAUCCAGGAC	
PVsiRNA-249596	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGAACAGGGAUGGAUCCAGGAC	
PVsiRNA-249597	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGAACAGGGAUGGAUCCAGGAC	
PVsiRNA-249598	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGAACAGGGAUGGAUCCAGGAC	
PVsiRNA-249599	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGAACAGGGAUGGAUCCAGGAC	
PVsiRNA-249600	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGAACAGGGAUGGAUCCAGGAC	
PVsiRNA-249601	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGAACAGGGAUGGAUCCAGGAC	
PVsiRNA-249602	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGAACAGGGAUGGAUCCAGGAC	
PVsiRNA-249603	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGAACAGGGAUGGAUCCAGGAC	
PVsiRNA-249604	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGAACAGGGAUGGAUCCAGGAC	
PVsiRNA-249605	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGAACAGGGAUGGAUCCAGGAC	
PVsiRNA-249606	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGAACAGGGAUGGAUCCAGGAC	
PVsiRNA-249607	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGAACAGGGAUGGAUCCAGGAC	
PVsiRNA-249608	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGAACAGGGAUGGAUCCAGGAC	
PVsiRNA-249609	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GACCCGCGACUCAGUAGUCCCU	
PVsiRNA-249610	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GACCCGCGACUCAGUAGUCCCU	
PVsiRNA-249611	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GACCCGCGACUCAGUAGUCCCU	
PVsiRNA-249612	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAAAGAAGGAAUGAGCGU	
PVsiRNA-249613	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAAAGAAGGAAUGAGCGU	
PVsiRNA-249614	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAAAGAAGGAAUGAGCGU	
PVsiRNA-249615	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAAAGAAGGAAUGAGCGU	
PVsiRNA-249616	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAAAGAAGGAAUGAGCGU	
PVsiRNA-249617	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAAAGAAGGAAUGAGCGU	
PVsiRNA-249618	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAAAGAAGGAAUGAGCGU	
PVsiRNA-249619	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAAAGAAGGAAUGAGCGU	
PVsiRNA-249620	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAAAGAAGGAAUGAGCGU	
PVsiRNA-249621	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAAAGAAGGAAUGAGCGU	
PVsiRNA-249622	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAAAGAAGGAAUGAGCGU	
PVsiRNA-249623	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAAAGAAGGAAUGAGCGU	
PVsiRNA-249624	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAAAGAAGGAAUGAGCGU	
PVsiRNA-249625	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAAAGAAGGAAUGAGCGU	
PVsiRNA-249626	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAAAGAAGGAAUGAGCGU	
PVsiRNA-249627	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAAAGAAGGAAUGAGCGU	
PVsiRNA-249628	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAAAGAAGGAAUGAGCGU	
PVsiRNA-249629	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAAAGAAGGAAUGAGCGU	
PVsiRNA-249630	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAAAGAAGGAAUGAGCGU	
PVsiRNA-249631	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAAAGAAGGAAUGAGCGU	
PVsiRNA-249632	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAAAGAAGGAAUGAGCGU	
PVsiRNA-249633	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAAAGAAGGAAUGAGCGU	
PVsiRNA-249634	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAAAGAAGGAAUGAGCGU	
PVsiRNA-249635	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAAAGAAGGAAUGAGCGU	
PVsiRNA-249636	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAAAGAAGGAAUGAGCGU	
PVsiRNA-249637	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCUGAAAGAAGGAAUGAGCGUA	
PVsiRNA-249638	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCUGAAAGAAGGAAUGAGCGUA	
PVsiRNA-249639	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCUGAAAGAAGGAAUGAGCGUA	
PVsiRNA-249640	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCUGAAAGAAGGAAUGAGCGUA	
PVsiRNA-249641	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCUGAAAGAAGGAAUGAGCGUA	
PVsiRNA-249642	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCUGAAAGAAGGAAUGAGCGUA	
PVsiRNA-249643	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGCAACACUUGUAGAAAAGCAC	
PVsiRNA-249644	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGCAACACUUGUAGAAAAGCAC	
PVsiRNA-249645	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGCAACACUUGUAGAAAAGCAC	
PVsiRNA-249646	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGCAACACUUGUAGAAAAGCAC	
PVsiRNA-249647	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGCAACACUUGUAGAAAAGCAC	
PVsiRNA-249648	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UAGUUGUCAACUGUAAUCACGG	
PVsiRNA-249649	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UAGUUGUCAACUGUAAUCACGG	
PVsiRNA-249650	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UAGUUGUCAACUGUAAUCACGG	
PVsiRNA-249651	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UAGUUGUCAACUGUAAUCACGG	
PVsiRNA-249652	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UAGUUGUCAACUGUAAUCACGG	
PVsiRNA-249653	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	ACAGGUGACGAAACAACGGAUG	
PVsiRNA-249654	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	ACAGGUGACGAAACAACGGAUG	
PVsiRNA-249655	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	ACAGGUGACGAAACAACGGAUG	
PVsiRNA-249656	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUUUGUUGGCAUACUUACUAUU	
PVsiRNA-249657	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUUUGUUGGCAUACUUACUAUU	
PVsiRNA-249658	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GCCAUCUACGUCCCAAUCUUUA	
PVsiRNA-249659	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GCCAUCUACGUCCCAAUCUUUA	
PVsiRNA-249660	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GCCAUCUACGUCCCAAUCUUUA	
PVsiRNA-249661	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GCCAUCUACGUCCCAAUCUUUA	
PVsiRNA-249662	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGCCGAUCUGUUCUCCAUUGCU	
PVsiRNA-249663	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGCCGAUCUGUUCUCCAUUGCU	
PVsiRNA-249664	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AUGUCCAGUCUUCAUUGUUCAU	
PVsiRNA-249665	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AUGUCCAGUCUUCAUUGUUCAU	
PVsiRNA-249666	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AUGUCCAGUCUUCAUUGUUCAU	
PVsiRNA-249667	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AUGUCCAGUCUUCAUUGUUCAU	
PVsiRNA-249668	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AUGUCCAGUCUUCAUUGUUCAU	
PVsiRNA-249669	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	CGCCAUCUACGUCCCAAUCUUU	
PVsiRNA-249670	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	CGCCAUCUACGUCCCAAUCUUU	
PVsiRNA-249671	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGUCCAGUCUUCAUUGUUCAUU	
PVsiRNA-249672	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGUCCAGUCUUCAUUGUUCAUU	
PVsiRNA-249673	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGUCCAGUCUUCAUUGUUCAUU	
PVsiRNA-249674	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGUCCAGUCUUCAUUGUUCAUU	
PVsiRNA-249675	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGUCCAGUCUUCAUUGUUCAUU	
PVsiRNA-249676	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGUCCAGUCUUCAUUGUUCAUU	
PVsiRNA-249677	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UGUCCAGUCUUCAUUGUUCAUU	
PVsiRNA-249678	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	CAGUCUUCAUUGUUCAUUGUGU	
PVsiRNA-249679	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAACAAAGCGAAAACGUG	
PVsiRNA-249680	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAACAAAGCGAAAACGUG	
PVsiRNA-249681	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAACAAAGCGAAAACGUG	
PVsiRNA-249682	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	CUGAGUUGCCUGUCUUUUCAUC	
PVsiRNA-249683	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	CUGAGUUGCCUGUCUUUUCAUC	
PVsiRNA-249684	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCACGGUUACUCUACUUCUGAA	
PVsiRNA-249685	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCACGGUUACUCUACUUCUGAA	
PVsiRNA-249686	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCACGGUUACUCUACUUCUGAA	
PVsiRNA-249687	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCACGGUUACUCUACUUCUGAA	
PVsiRNA-249688	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUGCUGAGUUGCUUGAUCAGGA	
PVsiRNA-249689	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUGCUGAGUUGCUUGAUCAGGA	
PVsiRNA-249690	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCGAUGUAUCGUUCUGCUCCU	
PVsiRNA-249691	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCGAUGUAUCGUUCUGCUCCU	
PVsiRNA-249692	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCGAUGUAUCGUUCUGCUCCU	
PVsiRNA-249693	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCGAUGUAUCGUUCUGCUCCU	
PVsiRNA-249694	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCGAUGUAUCGUUCUGCUCCU	
PVsiRNA-249695	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCGAUGUAUCGUUCUGCUCCU	
PVsiRNA-249696	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	CUACUGAGUUGCCUGUCUUUUC	
PVsiRNA-249697	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	GUAGCCGCCCAACAAACAUUGA	
PVsiRNA-249698	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UAGGAGAAGAGUGGUGUGACAU	
PVsiRNA-249699	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UAGGAGAAGAGUGGUGUGACAU	
PVsiRNA-249700	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UAGGAGAAGAGUGGUGUGACAU	
PVsiRNA-249701	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UAGGAGAAGAGUGGUGUGACAU	
PVsiRNA-249702	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UAGGAGAAGAGUGGUGUGACAU	
PVsiRNA-249703	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UAGGAGAAGAGUGGUGUGACAU	
PVsiRNA-249704	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UAGGAGAAGAGUGGUGUGACAU	
PVsiRNA-249705	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UAGGAGAAGAGUGGUGUGACAU	
PVsiRNA-249706	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UAGGAGAAGAGUGGUGUGACAU	
PVsiRNA-249707	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UAGGAGAAGAGUGGUGUGACAU	
PVsiRNA-249708	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UAGGAGAAGAGUGGUGUGACAU	
PVsiRNA-249709	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UAGGAGAAGAGUGGUGUGACAU	
PVsiRNA-249710	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UAGGAGAAGAGUGGUGUGACAU	
PVsiRNA-249711	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UAGGAGAAGAGUGGUGUGACAU	
PVsiRNA-249712	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UAGGAGAAGAGUGGUGUGACAU	
PVsiRNA-249713	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AGAUGACUGGCACCCAUGACGA	
PVsiRNA-249714	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAAGAUGACUGGCACCCAUGAC	
PVsiRNA-249715	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAAGAUGACUGGCACCCAUGAC	
PVsiRNA-249716	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAAGAUGACUGGCACCCAUGAC	
PVsiRNA-249717	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCUGAACCGUGAAUCUGAAGAA	
PVsiRNA-249718	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCUGAACCGUGAAUCUGAAGAA	
PVsiRNA-249719	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCUGAACCGUGAAUCUGAAGAA	
PVsiRNA-249720	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCUGAACCGUGAAUCUGAAGAA	
PVsiRNA-249721	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCUGAACCGUGAAUCUGAAGAA	
PVsiRNA-249722	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCUGAACCGUGAAUCUGAAGAA	
PVsiRNA-249723	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AGAGAAUGGCAGACCAAGAGCG	
PVsiRNA-249724	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AGAGAAUGGCAGACCAAGAGCG	
PVsiRNA-249725	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AGAGAAUGGCAGACCAAGAGCG	
PVsiRNA-249726	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AGAGAAUGGCAGACCAAGAGCG	
PVsiRNA-249727	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAACCGUGAAUCUGAAGA	
PVsiRNA-249728	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAACCGUGAAUCUGAAGA	
PVsiRNA-249729	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAACCGUGAAUCUGAAGA	
PVsiRNA-249730	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAACCGUGAAUCUGAAGA	
PVsiRNA-249731	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAACCGUGAAUCUGAAGA	
PVsiRNA-249732	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAACCGUGAAUCUGAAGA	
PVsiRNA-249733	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAACCGUGAAUCUGAAGA	
PVsiRNA-249734	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAACCGUGAAUCUGAAGA	
PVsiRNA-249735	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAACCGUGAAUCUGAAGA	
PVsiRNA-249736	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAACCGUGAAUCUGAAGA	
PVsiRNA-249737	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAACCGUGAAUCUGAAGA	
PVsiRNA-249738	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAACCGUGAAUCUGAAGA	
PVsiRNA-249739	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAACCGUGAAUCUGAAGA	
PVsiRNA-249740	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAACCGUGAAUCUGAAGA	
PVsiRNA-249741	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAACCGUGAAUCUGAAGA	
PVsiRNA-249742	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAACCGUGAAUCUGAAGA	
PVsiRNA-249743	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCUGAACCGUGAAUCUGAAGA	
PVsiRNA-249744	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCUGAACCGUGAAUCUGAAGA	
PVsiRNA-249745	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCUGAACCGUGAAUCUGAAGA	
PVsiRNA-249746	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCUGAACCGUGAAUCUGAAGA	
PVsiRNA-249747	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCUGAACCGUGAAUCUGAAGA	
PVsiRNA-249748	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UCUGAACCGUGAAUCUGAAGA	
PVsiRNA-249749	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAGAGAAUGGCAGACCAAGAGC	
PVsiRNA-249750	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAGAGAAUGGCAGACCAAGAGC	
PVsiRNA-249751	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAGAGAAUGGCAGACCAAGAGC	
PVsiRNA-249752	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAGAGAAUGGCAGACCAAGAGC	
PVsiRNA-249753	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAGAGAAUGGCAGACCAAGAGC	
PVsiRNA-249754	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	AAGAGAAUGGCAGACCAAGAGC	
PVsiRNA-249755	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAAAUUGAUGAUCGCGUA	
PVsiRNA-249756	Maize	Zea mays	RBSDV	Rice black streaked dwarf virus	27888127	Leaves	UUCUGAAAUUGAUGAUCGCGUA	
